Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nested PCR primer group, kit and detection method for specifically detecting sisal hemp purple leaf curl phytoplasma

A technique for planting plasmoids and primer sets, applied in biochemical equipment and methods, recombinant DNA technology, and microbial assay/inspection, etc., to achieve the effects of strong specificity, overcoming cumbersome steps, and shortening identification time

Active Publication Date: 2021-01-05
ENVIRONMENT & PLANT PROTECTION INST CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to overcome the technical defects of a large number of non-specific bands and a large number of false positive sequences in the existing phytoplasma universal primers when detecting sisal purple leafroll disease phytoplasma, in order to detect and identify sisal sisal quickly and accurately Purple leafroll disease, the present invention provides a set of high-efficiency molecular detection primers for sisal purple leafroll disease phytoplasma and a nested molecular detection method for sisal purple leafroll disease with strong specificity, high sensitivity, easy operation and reliable results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nested PCR primer group, kit and detection method for specifically detecting sisal hemp purple leaf curl phytoplasma
  • Nested PCR primer group, kit and detection method for specifically detecting sisal hemp purple leaf curl phytoplasma
  • Nested PCR primer group, kit and detection method for specifically detecting sisal hemp purple leaf curl phytoplasma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1, detection of sisal purple leafroll disease Phytoplasma nested PCR primer set acquisition

[0038] 1. Nested PCR amplification with universal primers and product cloning

[0039] The phytoplasma universal primer R16mF2 / R16mR1 (R16mF2: CATGCAAGTCGAACGGA / R16mR1: CTTAACCCCAATCATCGAC) was used to amplify the DNA of sisal purple leafroll disease-like plants by PCR.

[0040] Wherein, the reaction system of the first round of PCR amplification is as follows:

[0041]

[0042]

[0043] The reaction conditions for the first round of PCR amplification were: 94°C for 3 minutes; 35 cycles of 94°C for 30 seconds, 52°C for 30 seconds, and 72°C for 1 minute; 72°C for 10 minutes; and storage at 4°C.

[0044] After the first round of amplification was completed, the product was diluted 10 times, and the R16F2n / R16R2 primer (R16F2n: GAAACGACTGCTAAGACTGG / R16R2: TGACGGGCGGTGTGTACAAACCCCG) was used for nested amplification;

[0045] Among them, the reaction system of ne...

Embodiment 2

[0060] Embodiment 2, detect the specificity of sisal purple leafroll disease phytoplasma primer

[0061] The DNA of the diseased plants of sisal purple leafroll disease, as well as the common host pathogen Phytophthora nicotianae, Aspergilus niger, and the non-host pathogen Paramyrothecium roridum were selected. , Pestalotiopsistrachicarpicola, Fusarium solani, Coletotrichumgloeosporioides, Coletotrichum falcatum, Ustilagoscitaminea, Rice blast Genomic DNA of Magnaporthe oryzae, Xanthomonasoryzae pv. Oryzicola, and Bacilus subtilis were used as templates.

[0062] The plant DNA extraction of sisal purple leafroll disease was extracted by the plant DNA extraction kit of QIAGEN Company of Germany; Aspergilus niger, Paramyrothecium roridum, Pestalotiopsis trachicarpicola, Fusarium solani, Coletotrichum gloeosporioides ), Coletotrichum falcatum, Ustilago scitaminea, and Magnaporthe oryzae strain mycelia. The bacterial DNA extraction kit (Bacterial DNA kit, Omega bio-tek) extracti...

Embodiment 3

[0073] Embodiment 3: detect the sensitivity of sisal purple leaf curl disease phase primor primer

[0074] The method of constructing and extracting the 16S rDNA recombinant plasmid of Phytoplasma sisal purple leafroller is as follows:

[0075] Use the pEASY-T1 Cloning Kit to clone the PCR products (nucleotides shown in sequence 5 in the sequence listing) of the universal primers (R16mF2 / R16mR1 and R16F2n / R16R2), and the specific operations are as follows:

[0076] (1) Add 4 μL of PCR product and 1 μL of T1 carrier to mix, flick to mix well, centrifuge briefly, connect at 25°C for 15 min, and place it on ice after completion.

[0077] (2) When the Trans-T1 competent cells were similar to non-transformation, take 50 μL of competent cells and the ligation product and gently mix them, and ice-bath for 30 minutes.

[0078] (3) Remove the centrifuge tube from the ice, heat-shock in a water bath at 42°C for 60 seconds, then quickly insert it on ice for 2 minutes, add 250 μL of LB l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nested PCR primer group, a kit and a detection method for specifically detecting sisal hemp purple leaf curl phytoplasma. The nested PCR primer group consists of nucleotide shown in a sequence 1 in a sequence table, nucleotide shown in a sequence 2 in the sequence table, nucleotide shown in a sequence 3 in the sequence table and nucleotide shown in a sequence 4 in the sequence table. The detection method is a nested molecular detection method for the sisal hemp purple leaf curl phytoplasma, which is high in specificity, high in sensitivity, easy to operate and reliable in result.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a nested PCR primer set, a kit and a detection method for specifically detecting sisal purple leafroll disease phytoplasma. Background technique [0002] Sisal (Agave sisalana Perr.ex Engelm), also known as agave hemp, is a perennial herbaceous monocot xerophyte of the Agave family Agave. It is native to Mexico and is now mainly grown in Africa, Latin America, Planted in Asia and other places. Sisal fiber is tough and wear-resistant. It is widely used in fishery, transportation, metallurgy and other industries. It is a hard fiber with the largest amount and widest range in the world. In my country, sisal production areas are mainly distributed in tropical and subtropical regions such as Guangdong, Guangxi, and Hainan. The total area of ​​sisal in my country is about 30,000 hm 2 , with a total fiber output of 15,500 tons (according to the statistics of the South Asia Office in 2015...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6848C12Q1/04C12N15/11
CPCC12Q1/6848C12Q1/689C12Q2549/119
Inventor 吴伟怀易克贤王桂花鹿鹏鹏郑金龙贺春萍习金根黄兴梁艳琼谭施北陆英
Owner ENVIRONMENT & PLANT PROTECTION INST CHINESE ACADEMY OF TROPICAL AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More