Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

SmbHLH92 gene cloning primer, expression vector, function of regulating salvianolic acid biosynthesis and application

A technology for biosynthesis and salvianolic acid, which is applied in the fields of plant molecular biology and genetic engineering, and can solve the problems of few reports on the biosynthesis of salvianolic acid compounds.

Pending Publication Date: 2020-12-29
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It has been verified that bHLH transcription factors can regulate the biosynthesis of anthocyanins, alkaloids and terpenoids in plants such as Arabidopsis thaliana, tobacco and yew; less synthetic reports

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SmbHLH92 gene cloning primer, expression vector, function of regulating salvianolic acid biosynthesis and application
  • SmbHLH92 gene cloning primer, expression vector, function of regulating salvianolic acid biosynthesis and application
  • SmbHLH92 gene cloning primer, expression vector, function of regulating salvianolic acid biosynthesis and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Cloning of Salvia miltiorrhiza SmbHLH92 gene

[0024] According to the open reading frame of the SmbHLH92 sequence, the primers for full-length amplification of the gene were designed, and the cDNA of Salvia miltiorrhiza was used as a template, and the nucleotide sequence of the SmbHLH92 gene, such as SEQ ID No.1, was amplified by PCR. The full length of the gene was 666 bp. The amino acid sequence of SmbHLH92 was deduced after translation of the nucleotide sequence, including 221 amino acid residues, such as SEQ ID No.2.

Embodiment 2

[0025] Example 2 Subcellular localization experiment of Salvia miltiorrhiza SmbHLH92

[0026] 1) Construct the recombinant plasmid pCAMBIA1302-GFP-SmbHLH92. Design full-length amplification primers with enzyme cleavage sites (R primers remove the stop codon), F: 5′-CATG CCATGG ATGCTTCCTATTTCGAGCGATG-3′R: 5′- ACTAGT GCTGTCGTCAGCTGCCG-3'.

[0027] 2) The recombinant plasmid pCAMBIA1302-GFP-SmbHLH92 was transformed into Agrobacterium tumefaciens GV3101. The recombinant plasmid pCAMBIA1302-GFP-SmbHLH92 and the empty vector pCAMBIA1302-GFP are transformed into competent cells of Agrobacterium tumefaciens GV3101, and the steps are as follows: Take 10 μL of the constructed recombinant plasmid pCAMBIA1302-GFP-SmbHLH92 and the empty vector pCAMBIA1302-GFP plasmid , added to 100 μL GV3101 Agrobacterium competent cells, gently blown and mixed, ice bathed for 30 minutes; quick-frozen in liquid nitrogen for 3 minutes, 37 ° C water bath for 3 minutes, then transferred to ice for 3 minu...

Embodiment 3

[0030] Example 3 Obtaining and Expanding Culture of Danshen SmbHLH92-RNAi Transgenic Hairy Root Positive Strains

[0031] 1) RNAi primer design and PCR amplification. Select a specific fragment of 123bp in the SmbHLH92 gene as the RNAi target region (located at 529-651bp of the gene), design primers at both ends of the target region, and add attB sequence at the 5' end of the primer according to the Gateway operation principle, where the F primer Add attB1 sequence: GGGGACAAGTTTGTACAAAAAAGCAGGCT, R primers add attB2 sequence: GGGGACCACTTTGTACAAGAAAGCTGGGT. The primer sequences of SmbHLH92 RNAi are as follows:

[0032] SmbHLH92RNAiF:

[0033] 5′- GGGGACAAGTTTGTACAAAAAAGCAGGCT ACCACCACAGCACCCTCAAC-3′

[0034] SmbHLH92RNAiR:

[0035] 5′- GGGGACCACTTTGTACAAGAAAGCTGGGT CTAGCTGTCGTCAGCTGCCG-3′

[0036] 2) Construction of SmbHLH92-RNAi vector. BP reaction: Add 25ng attB-PCR recovery product, 75ng pDONR221 entry vector, 1μL BP clonase II enzyme, supplement ddH to the PCR react...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an encoding gene sequence of a Salvia miltiorrhiza Bunge bHLH transcription factor SmbHLH92 for regulating and controlling salvianolic acid synthesis. The gene SmbHLH92 provided by the invention has a nucleotide sequence as shown in SEQ ID No.1, and protein encoded by the gene has an amino acid sequence as shown in SEQ ID No.2. A subcellular localization experiment shows that the SmbHLH92 is localized in a cell nucleus. An SmbHLH92-RNAi vector is constructed, Salvia miltiorrhiza Bunge is subjected to genetic transformation, transgenic hairy roots are obtained, and compared with a reference strain (a strain obtained by transforming an RNAi empty vector), the SmbHLH92-RNAi strain has the advantage that the content of four phenolic acid components in the SmbHLH92-RNAistrain is remarkably increased. A real-time fluorescent quantitative PCR result shows that the expression quantity of a key enzyme gene in a salvianolic acid pathway is remarkably increased in the SmbHLH92-RNAi strain. The SmbHLH92 provided by the invention has a function of negatively regulating and controlling the biosynthesis of salvianolic acid compounds, and the compounds show outstanding curative effects in the aspect of treating cardiovascular and cerebrovascular diseases. The invention provides a new research thought for increasing the content of the salvianolic acid compounds by utilizing genetic engineering, and provides a target gene for developing excellent variety breeding of the Salvia miltiorrhiza Bunge.

Description

technical field [0001] The invention belongs to the fields of plant molecular biology and genetic engineering, and specifically relates to gene cloning and functional research of a SmbHLH92 transcription factor regulating salvianolic acid biosynthesis. Background technique [0002] Salvia miltiorrhiza Bunge is a perennial erect herbaceous plant of the genus Salvia in the Lamiaceae family. Its roots and rhizomes are used as medicine. , the effects of stimulating the menstrual flow and relieving pain, clearing heart-fire and relieving restlessness, cooling blood and eliminating carbuncle. The main active components of Danshen include fat-soluble tanshinone compounds and water-soluble salvianolic acid compounds. Salvianolic acid compounds mainly include Rosmarinic acid (RA), Salvianolic acid B (Sal B), Salvianolic acid A (Salvianolic acid A, Sal A) and Lithospermic acid (Lithospermic acid, LA), etc., they play an important role in anti-oxidation, scavenging free radicals, etc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/06A01H6/00
CPCC07K14/415C12N15/8243
Inventor 罗红梅张建红张鑫季爱加吕海舟宋经元
Owner INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com