Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

QRT-PCR reference gene of grapes as well as primers and application of qRT-PCR reference gene

An internal reference gene and gene technology, applied in the field of molecular biology, can solve problems such as lack of internal reference gene research

Active Publication Date: 2020-12-01
HENAN UNIV OF SCI & TECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in grapes, the research on internal reference genes is still relatively scarce, and there are many varieties of grapes, and a large number of new varieties have been bred in recent years, all of which lead to a certain degree of blindness in the selection of internal reference genes in grapes. Absolutely ideal internal reference genes to choose from

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • QRT-PCR reference gene of grapes as well as primers and application of qRT-PCR reference gene
  • QRT-PCR reference gene of grapes as well as primers and application of qRT-PCR reference gene
  • QRT-PCR reference gene of grapes as well as primers and application of qRT-PCR reference gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Discovery of candidate internal reference genes

[0039] 1. Plant material and handling

[0040] In this study, the fruits, leaves and tendrils of seven grape varieties (Mauscarpa, Prickly Grape, Jingya, Beauty Finger, Zhengzhou Zaohong, Stenosaurus, Cabernet Sauvignon) and nine different developmental stages of 'Kyoho' grape were collected. Fruits and materials were collected from Zhengzhou Institute of Pomology, Chinese Academy of Sciences. The fruits of different developmental stages of 'Kyoho' and 'Fengzao' (an early-maturing bud variety of 'Kyoho') were collected at the experimental base of Henan University of Science and Technology. The five developmental stages of 'Kyoho' were collected, respectively represented by K1-K5; 'Feng Four developmental stages were collected in Zao', represented by F1-F4 respectively. Hydrogen peroxide (H 2 o 2), riboflavin and 5-azacytidine (5-azaC) were treated with ‘Kyoho’ grapes. The concentration of hydrogen peroxid...

Embodiment 2

[0043] Example 2: Design of primers for candidate internal reference genes

[0044] qRT-PCR primers were designed with Primer 5 software, and the nucleotide sequences of the primers are shown in Table 1.

[0045] Wherein, the primers for specific amplification of RRM1 gene are as follows:

[0046] F: ATGGACTCAGACGAAGGAAAGC (SEQ ID NO. 4)

[0047] R: CGAATACCACAAAAGCCAAAGC (SEQ ID NO.5)

[0048] The primers used to specifically amplify the Ubiquitin gene are as follows:

[0049] F: GTGGTATTATTGAGCCATCCTT (SEQ ID NO. 22)

[0050] R:AACCTCCAATCCAGTCATCTAC (SEQ ID NO. 23)

[0051] The primers used to specifically amplify the EF1-α gene are as follows:

[0052] F: GAACTGGGTGCTTGATAGGC (SEQ ID NO. 20)

[0053] R: AACCAAAATATCCGGAGTAAAAAGA (SEQ ID NO. 21)

[0054] Table 1. Ten candidate internal reference genes and their primer sequences

[0055]

Embodiment 3

[0056] Example 3: Stability analysis of candidate internal reference genes

[0057] 1. Total RNA extraction and cDNA synthesis

[0058] The collected samples (fruits, leaves, tendrils of grapes) were ground into powder form with liquid nitrogen. The total RNA was extracted using a polysaccharide and polyphenol total RNA extraction kit (TIANGEN, Beijing). For specific methods, refer to the instruction manual. The quality and integrity of the extracted RNA were checked by 1% agarose gel electrophoresis. Using the extracted total RNA as a template, use First-strand cDNA synthesis kit (Vazyme, Nanjing) was used to synthesize cDNA, and the specific method was referred to the instruction manual, and the synthesized cDNA was stored in a -20°C refrigerator.

[0059] 2. Real-time fluorescent quantitative PCR (qRT-PCR)

[0060] The total qRT-PCR reaction system was 10 μL, including 5 μL 2×TransStart Top Green qPCR SuperMix (Quanshi Jinbiology, Beijing), 1 μL cDNA, 0.3 μL forward an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a qRT-PCR reference gene of grapes as well as primers and application of the qRT-PCR reference gene. A new grape reference gene RRM1 is identified for the first time, and qRT-PCR primers aiming at the gene are designed. According to transcriptome data in an earlier stage, the stability of seven candidate reference genes, namely, Actin, 18s-rRNA, GAPDH, VvEF1-gamma, VvEF1-alpha, EF1-alpha and Ubiquitin, and three newly explored candidate reference genes, namely, RRM1, PPR2 and MRE11 in fruits, leaves and beard curls of seven different grape varieties and Kyoho fruit samples of nine different development stages is analyzed. Results show that the number of optimal reference genes for the grape sample is two, the selection of the optimal reference genes for different samples is different, the optimal reference genes in grape leaf tissues are RRM1 and EF1-alpha, and the optimal candidate reference genes are RRM1 and Ubiquitin when all the samples are contained. The qRT-PCR kit can provide important reference for related researchers to carry out qRT-PCR work in grapes.

Description

technical field [0001] The invention relates to a grape qRT-PCR internal reference gene, primers and applications thereof, and belongs to the technical field of molecular biology. Background technique [0002] Grapes are one of the most important fruit trees widely grown worldwide. The fruit of grapes can be eaten fresh or used to make wine and raisins, so it has high nutritional and economic value. At present, relevant researchers have discovered and cultivated a large number of new grape varieties, and have carried out a lot of scientific research work using these germplasm resources. Research on the molecular mechanism of important agronomic traits of grapes and related functional genes has greatly promoted the development of the grape industry. [0003] In the process of carrying out basic research on grapes, real-time fluorescent quantitative PCR (qRT-PCR) technology has played an important role, which has many advantages such as short reaction time, good repeatabilit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/686C12N15/11
CPCC12Q1/6895C12Q1/686C12Q2600/166C12Q2600/13C12Q2561/113C12Q2563/107C12Q2545/114
Inventor 郭大龙韦同路余义和裴茂松刘海楠郑玉萍陈苏丹
Owner HENAN UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com