miRNA detection kit based on sulfo-modified loop-mediated isothermal amplification method
A detection kit and ring-mediated isothermal technology, applied in the biological field, can solve the problems of easy false positive results, low detection throughput, and low sensitivity, and achieve the effects of good specificity, enhanced amplification efficiency, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] A miRNA detection kit based on thio-modified ring-mediated isothermal amplification method, which can detect the concentration of target miRNA based on thio-modified ring-mediated isothermal amplification. Taking miR-200a as the detection object as an example, the complementary sequence of the target miRNA is divided into two parts, which are respectively designed on the hairpin structure DNA of two linker probes Linker A / B. When the target miRNA appears, the two Linker probes The needles are hybridized with miRNAs, close to each other, and ligated under the action of SplintR ligase to form dumbbell-shaped amplicons with stem-loop structures at both ends. Amplification primers (PS FIP / BIP) are added to the reaction system to combine the amplicon with the internal primer, and start DNA synthesis driven by Bst 2.0 DNA polymerase with strand displacement activity to form a new hairpin structure and extend it. A cyclic amplification and strand displacement process results i...
Embodiment 2
[0061] 1. Materials and methods
[0062] 1.1 Primers and probes
[0063] The LAMP primers in this kit are provided by PrimerExplorer V5 ( http: / / primerexplorer.jp / lampv5e / index.html )design. The primer and probe sequences are as follows (bases underlined are thiox):
[0064] Connector probe:
[0065] Linker A
[0066] AGCACCCTCAACATCGAAGC ACTCGTGAAGAGGCTGTAAGGCAAGTTCGAAGCTGGATAGGCTTCGATGTTGAGGGTGCTACATCGTTACC,
[0067] Linker B
[0068] Phosphate AGACAGTGTTATGCTTCCCGTAATGCATGTGGCACCAATGTGCCTCTACAATTAGGATTTTCAACTGGTGTGAACTTTGTTGTTCAGCCAGT CCACATGCATTACGGGAAGCA .
[0069] Thio primer:
[0070] PS FIP primer
[0071] AGCACCCTCAACATCGAAGC ACTCGTGAAGAGGCTGTA,
[0072] PS BIP primer
[0073] TGCTTCCCGTAATGCATGTGG ACTGGCTGAACAACAAAGT.
[0074] Signal probe:
[0075] FAM CACACCACTTCTACAATTAGGATTTTCAACTGGTGTG BHQ.
[0076] All DNA sequences were synthesized by Shanghai Sangon Bioengineering Co., Ltd.
[0077] 1.2 RNA extraction from cell samples
[0078]AxyPrep...
Embodiment 3
[0093] Detection of miRNA concentration in cells
[0094] Using the standard curve method, the PS-LAMP method was applied to the determination of the content of miR-200a in the total RNA samples extracted from HT 29 human colon cancer cells. The results showed that miR-200a in the total RNA of human colon cancer cells (0.5 μg / μL) The content is 0.65pmol / L, which is consistent with the determination result of stem-loop RT-PCR.
[0095] Detection of miRNA concentration in serum
[0096] The PS-LAMP method was applied to the screening of novel miRNA tumor markers in papillary thyroid carcinoma in serum. Compared with healthy people, in the serum of patients with papillary thyroid carcinoma, miR-146 was significantly increased, while miR-199 was significantly decreased. A miRNA as a biomarker can effectively screen out patients with thyroid cancer. As shown in Table 1, the concentrations of miR-146 and miR-199 in the serum of patients with papillary thyroid carcinoma and healthy...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap