Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

miRNA detection kit based on sulfo-modified loop-mediated isothermal amplification method

A detection kit and ring-mediated isothermal technology, applied in the biological field, can solve the problems of easy false positive results, low detection throughput, and low sensitivity, and achieve the effects of good specificity, enhanced amplification efficiency, and high sensitivity

Active Publication Date: 2020-11-20
ZHEJIANG UNIV
View PDF12 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, each method has its own disadvantages, such as low detection throughput, cumbersome, time-consuming, low sensitivity, prone to false positive results, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • miRNA detection kit based on sulfo-modified loop-mediated isothermal amplification method
  • miRNA detection kit based on sulfo-modified loop-mediated isothermal amplification method
  • miRNA detection kit based on sulfo-modified loop-mediated isothermal amplification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] A miRNA detection kit based on thio-modified ring-mediated isothermal amplification method, which can detect the concentration of target miRNA based on thio-modified ring-mediated isothermal amplification. Taking miR-200a as the detection object as an example, the complementary sequence of the target miRNA is divided into two parts, which are respectively designed on the hairpin structure DNA of two linker probes Linker A / B. When the target miRNA appears, the two Linker probes The needles are hybridized with miRNAs, close to each other, and ligated under the action of SplintR ligase to form dumbbell-shaped amplicons with stem-loop structures at both ends. Amplification primers (PS FIP / BIP) are added to the reaction system to combine the amplicon with the internal primer, and start DNA synthesis driven by Bst 2.0 DNA polymerase with strand displacement activity to form a new hairpin structure and extend it. A cyclic amplification and strand displacement process results i...

Embodiment 2

[0061] 1. Materials and methods

[0062] 1.1 Primers and probes

[0063] The LAMP primers in this kit are provided by PrimerExplorer V5 ( http: / / primerexplorer.jp / lampv5e / index.html )design. The primer and probe sequences are as follows (bases underlined are thiox):

[0064] Connector probe:

[0065] Linker A

[0066] AGCACCCTCAACATCGAAGC ACTCGTGAAGAGGCTGTAAGGCAAGTTCGAAGCTGGATAGGCTTCGATGTTGAGGGTGCTACATCGTTACC,

[0067] Linker B

[0068] Phosphate AGACAGTGTTATGCTTCCCGTAATGCATGTGGCACCAATGTGCCTCTACAATTAGGATTTTCAACTGGTGTGAACTTTGTTGTTCAGCCAGT CCACATGCATTACGGGAAGCA .

[0069] Thio primer:

[0070] PS FIP primer

[0071] AGCACCCTCAACATCGAAGC ACTCGTGAAGAGGCTGTA,

[0072] PS BIP primer

[0073] TGCTTCCCGTAATGCATGTGG ACTGGCTGAACAACAAAGT.

[0074] Signal probe:

[0075] FAM CACACCACTTCTACAATTAGGATTTTCAACTGGTGTG BHQ.

[0076] All DNA sequences were synthesized by Shanghai Sangon Bioengineering Co., Ltd.

[0077] 1.2 RNA extraction from cell samples

[0078]AxyPrep...

Embodiment 3

[0093] Detection of miRNA concentration in cells

[0094] Using the standard curve method, the PS-LAMP method was applied to the determination of the content of miR-200a in the total RNA samples extracted from HT 29 human colon cancer cells. The results showed that miR-200a in the total RNA of human colon cancer cells (0.5 μg / μL) The content is 0.65pmol / L, which is consistent with the determination result of stem-loop RT-PCR.

[0095] Detection of miRNA concentration in serum

[0096] The PS-LAMP method was applied to the screening of novel miRNA tumor markers in papillary thyroid carcinoma in serum. Compared with healthy people, in the serum of patients with papillary thyroid carcinoma, miR-146 was significantly increased, while miR-199 was significantly decreased. A miRNA as a biomarker can effectively screen out patients with thyroid cancer. As shown in Table 1, the concentrations of miR-146 and miR-199 in the serum of patients with papillary thyroid carcinoma and healthy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an miRNA detection kit based on a sulfo-modified loop-mediated isothermal amplification method. The miRNA detection kit consists of a loop-mediated amplification reaction solution, an enzyme, a primer and probe mixed solution and a standard substance. Dumbbell-shaped DNA formed by connecting a base sulfo-modified linker probe Linker A / B in the presence of target miRNA is used as an amplicon and is combined with the same part of base sulfo-modified FIP / BIP primers to initiate LAMP exponential amplification; a sulfo-modified DNA structure can further enhance the amplification efficiency, the formed amplification product opens a signal probe-molecular beacon to generate a fluorescence signal, and the fluorescence signal of the target product is monitored by a real-timefluorescence quantitative PCR instrument, so that the target miRNA is detected, and the miRNA detection kit has the characteristics of strong stability, good specificity and high sensitivity. The miRNA detection kit can be used for detecting various miRNAs in serum of a papillary thyroid cancer patient, and can be used as a tumor marker for auxiliary diagnosis of papillary thyroid cancer.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a new technology for detecting miRNA concentration in biological samples (cells, serum, etc.) of patients with major diseases such as tumors, in particular to a miRNA detection kit based on thio-modified ring-mediated isothermal amplification. It can provide a highly sensitive basis for auxiliary judgment of tumor markers in biological samples for the early diagnosis of clinical thyroid cancer and other major diseases. Background technique [0002] miRNA is a class of single-stranded non-coding RNA molecules with a length of about 20-25 nucleotides. It is also one of the important biomarkers used in modern molecular biology to identify various cellular functions, biology and pathological processes. miRNAs recognize mRNA target sequences through complementary base pairing to regulate post-transcriptional modification of gene transcription, interfere with the translation of mRNA, or caus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6851
CPCC12Q1/6851C12Q1/6886C12Q2600/158C12Q2600/166C12Q2600/178C12Q2531/119C12Q2525/117C12Q2563/107C12Q2525/207C12Q2545/114C12Q2537/1376
Inventor 蔡圣加德拉·塔拉甫沈敏哲余露山曾苏
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com