Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Set of antisense RNA for inhibiting AMH gene expression and method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain

A technology of gene expression and tilapia, applied in chemical instruments and methods, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of easy broken egg shells and low success rate, and achieve egg damage and success The effect of high rate and strong application prospect

Pending Publication Date: 2020-11-17
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Fish fertilized eggs have thick egg shells and high internal pressure. Therefore, the egg shells are easily broken during microinjection and the success rate is extremely low.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Set of antisense RNA for inhibiting AMH gene expression and method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain
  • Set of antisense RNA for inhibiting AMH gene expression and method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain
  • Set of antisense RNA for inhibiting AMH gene expression and method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] The acquisition of a set of antisense RNAs for promoting gonadal degeneration of tilapia males comprises the following steps:

[0068] Step 1: Design of the first antisense RNA sequence (Anti-AMH-1):

[0069] TTTTTCCATTCAAAGTTAACGAGTTATTAATTAATCAGCTGAGCGGCGTCTGACCGGTTACTGTGGGGTCCTGGGCCGGTTGCAGGGTCCAGCAGAGTGTCAGCGCC (SEQ ID No. 1).

[0070] The antisense RNA includes the first intron partial sequence and the first exon partial sequence, and its design purpose is to interfere with the post-transcriptional processing of the AMH gene.

[0071] Step 2: The second antisense RNA sequence design (Anti-AMH-2):

[0072] GTGTCAGCGCCTCGCTGTAAAGAACGAGCAGACCCAACATGTTTGCAGTGTCTGCGTGTGCGTTTGTGTGGTCAGATCTCTCACAGGATGGGAGTTACATCCT (SEQ ID No. 2).

[0073]The antisense RNA contains part of the 5-terminal untranslated sequence and the first exon partial sequence, including the initiation codon, and its design purpose is to interfere with the translation of the AMH gene.

Embodiment 2

[0075] The two antisense RNAs designed in Example 1 were entrusted to Suzhou Jinweizhi Biotechnology Co., Ltd. for artificial synthesis to obtain antisense RNA1 and antisense RNA2.

[0076] PCR amplification: the antisense RNA1 and antisense RNA2 are respectively cloned into the pcDNA3.1 expression vector (containing the highly expressed CMV promoter), and this product is used as a template for subsequent PCR amplification. A pair of specific primers were designed for template amplification (PolyAF2:TTTTGCGCTGCTTCGCGATGTAC, SEQ ID NO.3; reverse primer polyAR1:TCCCCAATCCTCCCCCTTGCTG, SEQ ID NO.4). The reaction system is 50 μl, including 25 μl of 2×Mastermix, 5 μl of primers, 18 μl of ultrapure water, and 2 μl of template. The amplification program was: pre-denaturation at 95°C for 2 min, 34 cycles (denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 2 min); extension at 72°C for 5 min. This PCR product contains the CMV enhancer to the tailing seque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a set of antisense RNA for inhibiting AMH gene expression and a method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain, and belongs to thetechnical field of aquaculture breeding. The antisense RNA for inhibiting AMH gene expression comprises antisense RNA1 and antisense RNA2, can accurately inhibit the transcriptional level of anti-mullerian hormone gene mRNA, interferes mRNA transport and translation of the anti-mullerian hormone gene mRNA, and influences the protein expression level of the anti-mullerian hormone gene mRNA. The invention further provides the method for promoting gonad degeneration of male tilapia mossambica and increasing weight gain. Two antisense RNAs are introduced into ova by adopting an antisense RNA sequence introduction technology, damage to the ova is small, and the success rate is high. The method can effectively carry out target gene research and development of new disease-resistant and growth-promoting varieties, and has a very strong application prospect.

Description

technical field [0001] The invention belongs to the technical field of aquatic breeding, and in particular relates to a set of antisense RNA for inhibiting AMH gene expression and a method for promoting gonad degeneration and weight gain of tilapia male fish. Background technique [0002] Tilapia is widely farmed in southern my country, with an annual output of more than 1.4 million tons, ranking first in the world. During the breeding process, farmers prefer to raise male tilapia. Because before sexual maturity, male and female tilapia grow no differently. However, after sexual maturity, female fish need to consume a lot of nutrients during ovarian development, completely stop feeding during hatching; also eat very little during nursing juveniles; and reproduce several times a year, and their growth slows down significantly. Thus, tilapia males grow more than 30 percent faster than females. [0003] Anti-Müllerian hormone (AMH) gene inhibits the formation of Müllerian du...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/85A01K67/027
CPCA01K67/0276A01K2217/058A01K2227/40A01K2267/02C07K14/575C12N15/1136C12N15/8509C12N2310/11
Inventor 强俊曹哲明徐跑李红霞陶易凡朱昊俊马俊蕾刘凯
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com