Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-CLDN 18 fully-humanized antibody for treatment of late gastric cancer

A fully humanized, advanced gastric cancer technology, applied in the direction of antibodies, recombinant DNA technology, and the use of vectors to introduce foreign genetic materials, can solve the problems of reduced expression of intestinal type gastric cancer and Claudin18 expression

Active Publication Date: 2020-09-25
BEIJING KAWIN TECH SHARE HLDG
View PDF11 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In 2006, Sanada et al. found that the expression of Claudin18 gene was down-regulated in 57% of gastric cancers. Through immunohistochemical analysis, Claudin18 was expressed on the cell membrane of normal gastric mucosa and duodenal Paneth cells, but in some intestinal carcinomas and 90% microscopic In adenoma, the expression of Claudin18 is reduced, and the expression reduction of intestinal type gastric cancer is more common than other types of gastric cancer. It is speculated that it may be involved in the occurrence of early gastric cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-CLDN 18 fully-humanized antibody for treatment of late gastric cancer
  • Anti-CLDN 18 fully-humanized antibody for treatment of late gastric cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Construction of HEK293 cells expressing Claudin18.1 and Claudin18.2 antigens

[0044] The pcDNA3.1 vector (purchased from Invitrogen) encoding human Claudin18.1 and Claudin18.2 antigens was transfected into HEK293 cells (purchased from ATCC), and 200 μg / mL geneticin was used as the selection pressure to obtain stable expression of Claudin18.1 and Claudin18.1. HEK293 cells with Claudin18.2 antigen. Using Ganymed’s Claudin18.2 antibody IMAB362 (self-made, transiently expressed in CHO-S cells, and further chromatographically purified, refer to Examples 2 and 3, denoted as ch163 in the present invention) as a positive antibody, the stable expression was screened by FACS method HEK293 cells with human Claudin18.1 and Claudin18.2 antigens.

Embodiment 2

[0045] Example 2 Construction of Candidate Antibody KW-2 Expression Vector

[0046] The HindIII restriction site ( AAGCTT ), KoZAK sequence ( GCCGCCACC ), ATG, signal peptide gene GAGAGAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGT and antibody heavy chain coding gene (including heavy chain variable region coding gene SEQ ID NO: 11 and constant region IgG1 coding gene SEQ ID NO: 17), termination code TAA and EcoRI coding gene GAATTC Sequential fusion in series, and the use of chemical synthesis to obtain gene fragments. Through the EcoRI and HindIII sites, the above fragment was inserted into the eukaryotic expression plasmid pCDNA 3.4(+) ((purchased from Invitrogen)) and verified by sequencing to obtain the expression plasmid pCDNA3.4(+)-BY6-4 of the antibody heavy chain .

[0047] The HindIII restriction site ( AAGCTT ), KoZAK sequence ( GCCGCCACC ), ATG, signal peptide gene GAGAGAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGT and antibody light chain cod...

Embodiment 3

[0050] Example 3 Expression and purification of anti-Claudin18.2 antibody

[0051] Using the DNA constructs described in Example 2, they were respectively transiently transferred to CHO-S cells (purchased from Invitrogen) to express the target antibody, according to the CHO-S cell operation manual (Freedom TM CHO-S TM KitUSER GUIDE), adjust the cell density to 1x10 the day before plasmid transfection 6 individual / ml. On the day of plasmid transfection, mix with the transfection reagent and add to EXPICHOEXPRESSION MEDIUM cell culture medium (purchased from Invitrogen Company), 37°C, 8% CO2 Continue to culture until the 8th day, collect the cell liquid, and remove the cells by centrifugation, 0.2 μm After filtration, Protein A affinity chromatography was used for purification, and the pH of the collected samples was adjusted to 5.5, and stored at 2-8°C. The purified antibody was detected by SDS PAGE and SEC, and the purity was above 95%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an anti-Claudin18.2 fully-humanized monoclonal antibody for treatment of late gastric cancer. The antibody has higher humanization degree and relatively lower immunogenicity compared with the existing Claudin18.2 antibody IMAB362 of Ganymed, selectively binds to CLDN18.2, and has relatively higher affinity.

Description

technical field [0001] The invention relates to an anti-CLDN18.2 (Claudin18.2) fully humanized antibody for treating advanced gastric cancer, belonging to the field of biotechnology. Background technique [0002] Gastric cancer is one of the most common cancers worldwide and the second most common cancer in China. According to the disclosure at the 12th International Gastric Cancer Conference held in Beijing in April 2017, about 680,000 new cases of gastric cancer are discovered in China every year, accounting for about half of the total number of cases in the world. Compared with the 446,500 cases announced in 2012, the average annual increase rate exceeded 13%. The death rate of gastric cancer in China is 4 to 8 times that of developed countries in Europe and the United States. About every 2 to 3 minutes, one Chinese person dies of gastric cancer. Compared with other countries, the situation of gastric cancer in China is more serious. [0003] When most gastric cancer p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C12N15/13A61K39/395A61P35/00C12N15/85C12N5/10
CPCC07K16/28A61P35/00C12N15/85C07K2317/56C07K2317/24C07K2317/52C07K2317/92A61K2039/505
Inventor 许铮李响刘影熊国裕李峰史继峰上官丽娟
Owner BEIJING KAWIN TECH SHARE HLDG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com