Fusion type Taq DNA polymerase as well as preparation method and application thereof
A polymerase and fusion technology, applied in the biological field, can solve problems such as affecting the detection rate and detection limit of trace templates, reducing sensitivity and amplification efficiency, and ineffective amplification, achieving good amplification performance and improving amplification. The effect of increasing speed and impurity tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] The preparation of embodiment 1 fusion type Taq DNA polymerase
[0064] The nucleic acid sequence shown in SEQ ID NO:5 is loaded into pET28, purified by a histidine tag (His-Tag), and an expression vector of fusion-type Taq DNA polymerase is constructed; the successfully constructed expression vector is transferred into a host cell, Culture in liquid medium, when OD600 = 0.4-0.6, add IPTG with a final concentration of 1 mM, and induce expression overnight at 16° C. and 180 rpm. The bacteria were collected, subjected to column purification after ultrasonic disruption, and the steps were as follows:
[0065] (1) Using a low-pressure chromatography system, the supernatant was loaded onto a Ni-IDA Binding-Buffer pre-equilibrated Ni-IDA-Sepharose Cl-6B affinity chromatography column at a flow rate of 0.5 mL / min (Sangon Biotech Engineering (Shanghai) Co., Ltd.);
[0066] (2) Use Ni-IDA Binding-Buffer to wash the chromatography column at a flow rate of 0.5mL / min until the OD...
Embodiment 2
[0072] In this example, λDNA is used as a template, and human whole blood is used as an impurity to put into the λDNA template, and the input amounts are 0%, 5%, 10% and 15%, respectively, and PCR amplification is carried out by using fusion-type DNA polymerase (Taq-M2) , primers are as shown in SEQ ID NO:6~7, the amplification system is as shown in Table 1, and a wild-type Taq DNA polymerase (Taq) control group is set, and the amplification system of the control group is as shown in Table 2;
[0073] Lambda DNA upstream primer (SEQ ID NO: 6): AGCAGTGCAGCGAACTGAGC;
[0074] Lambda DNA downstream primer (SEQ ID NO: 7): AAGCGCAGACGGTCGATGT.
[0075] Table 1 Fusion DNA polymerase (Taq-M2) amplification system
[0076]
[0077]
[0078] Table 2 wild-type Taq DNA polymerase (Taq) amplification system
[0079] Element Amount added (μL) Champagne Taq DNA polymerase (5U / μL) 1 10×Champagne Taq Buffer (Mg 2+ plus)
2 λDNA upstream primer (10μM) 0...
Embodiment 3
[0085] In this embodiment, the porcine diarrhea coronavirus (PEDV) vaccine is used as a sample, and the viral nucleic acid rapid extraction kit (product number R312-01) is used to extract viral RNA, and the steps are as follows:
[0086] (1) Add 200 μL of absolute ethanol to a 1.5 mL RNase-free centrifuge tube, and pre-pack multiple samples;
[0087] (2) Add 200 μL sample and vortex to mix;
[0088] (3) Put the adsorption column in a 2mL collection tube, add the above mixed solution to the adsorption column, and centrifuge at 12000g for 1min;
[0089] (4) Discard the filtrate, put the adsorption column back into the 2mL collection tube, add 600 μL of rinsing solution (add absolute ethanol in advance), centrifuge at 12000 g for 30 sec, and discard the filtrate;
[0090] (5) Repeat step (4) once;
[0091] (6) Put the adsorption column back into the collection tube, and centrifuge the empty column at 12000g for 2min;
[0092] (7) Transfer the adsorption column to a new 1.5mL c...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap