Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method and application of CD45-DTR transgenic mouse for regulating and removing immune cells by diphtheria toxin

A technology of CD45-DTR and transgenic mice, applied in other methods, applications, and immunoassays of inserting foreign genetic materials, can solve the problems of normal cells being easily affected, unstable passage, poor selectivity, etc., and achieve good immunity cell effect

Pending Publication Date: 2020-09-01
乾元康安(苏州)生物科技有限公司
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are still some shortcomings in the use of DT to induce and prepare animal models of immune cell clearance, such as unstable passage, low efficiency of immune cell clearance, poor selectivity, and normal cells are easily affected.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of CD45-DTR transgenic mouse for regulating and removing immune cells by diphtheria toxin
  • Construction method and application of CD45-DTR transgenic mouse for regulating and removing immune cells by diphtheria toxin
  • Construction method and application of CD45-DTR transgenic mouse for regulating and removing immune cells by diphtheria toxin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Construction of BAC Clone CD45-DTR vector.

[0046] (1) Construct a targeting vector that integrates foreign genes into the exon 1 site of mouse CD45, the procedure is as follows: figure 1 Shown:

[0047] The mouse CD45 genome sequence was retrieved and downloaded from the genome.ucsc.edu website, combined with the mouse CD45 (Genbank No: NM_001111316.2) sequence, the positions and sequences of each exon and intron were determined. BAC Clone containing the entire CD45 gene: RP23-180D23 was purchased from Children’s hospital Oakland Research Institute, and BAC DNA was used HiPure Plasmid Filter Maxiprep Kit (Invitrogen) was prepared for use.

[0048] The target gene fragment CD45 5' side homology arm (CD45 5HA) was amplified by PCR: using RP23-180D23 BAC DNA as a template, using the forward primer CD45-5HA-F(KpnI)-ACCACCGGTACCGTGCAAAGTATGCGTTCTTTTCTTTAG(SEQ ID NO.1), The reverse primer CD45-5HA-R(SalI)-AACAACGTCGAC ATCTGGAGATCAGCTGTGCCC (SEQ ID NO.2) was used for PCR...

Embodiment 2

[0077] Insertion of CD45-DTR into mouse embryonic stem (ES) cells:

[0078] Mouse embryonic fibroblasts (MEFs) culture: MEFs (ATCC) were cultured and maintained in MEF medium, passaged and frozen in time. The MEF medium is DMEM medium supplemented with 10% FBS, 100 U / ml penicillin streptomycin, 0.05 mM 2-mercaptoethanol, and 2 mM L-glutamine.

[0079] Balb / c ES cell culture: MEFs cells were inactivated with 30 Gray γ-rays before use as trophoblast cells, Balb / c ES cells (Merck) were inoculated onto the inactivated MEFs, cultured and maintained with ES medium. ES cells were grown to 70% abundance and passaged at a ratio of 1:3. ES medium is DMEM medium with 15% FBS, 100U / ml penicillin, 1mM sodium pyruvate, 0.1mM non-essential amino acid, 0.05mM 2-mercaptoethanol, 2mM L-glutamine, 1μg / L leukemia inhibitory factor (LIF).

[0080] Electroporation of ES cells: ES cells were collected by trypsinization, washed once with PBS, resuspended in electroporation buffer (Millipore), and ...

Embodiment 3

[0089] Breeding BAC clone CD45-DTR transgenic mice, the procedure is as attached Figure 7 shown.

[0090] Blastocyst injection of ES cells to obtain CD45-DTR transgenic chimera mice: Select 8-week-old well-developed C57BL / 6J male mice and C57BL / 6J female mice in a 1:2 cage, and select vaginal plug-positive female mice in the morning of the next day , if the female mouse is pregnant 5 days later, blastocysts can be obtained in the uterus. Ligated KM male mice and normal KM female mice were caged at a ratio of 1:2, and the female mice with vaginal plugs and swollen and ruddy vulva were selected as pseudopregnant KM female mice. ES cells inserted into CD45-DTR were injected into C57BL / 6J mouse blastocysts, and then inoculated into the uterus of pseudopregnant KM female mice, and chimeric mice (F0) were born, that is, cells derived from C57 and BALB / c The derived ES cells co-exist in the same individual, and the animal coat color is black and white mixed.

[0091] Method for e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and application of a CD45-DTR transgenic mouse for regulating and removing immune cells by diphtheria toxin. The preparation method comprises the following steps: performing enzyme digestion linearization on BAC Cone CD45-DTR; introducing BALB / C ES cells of mouse embryonic stem cells by using an electroporation method to obtain the BALB / C ES cells withIRES-DTR being inserted into the site 1 of the CD45 exon; and then, constructing a CD45-DTR transgenic mouse with the IRES-DTR being inserted into the site 1 of the CD45 exon through a blastocyst injection method by utilizing the BALB / C ES cells. The invention provides a novel construction method of a mouse model capable of inducing and selectively removing immune cells. The method can be widelyapplied to the fields of preparation of humanized mice, research of immune cell functions and the like.

Description

technical field [0001] The invention relates to the field of animal model construction. More specifically, it relates to a method for constructing CD45-DTR transgenic mice in which diphtheria toxin regulates and eliminates immune cells. [0002] technical background [0003] Immune cells refer to cells that participate in or are related to immune responses. Including lymphocytes, dendritic cells, monocytes / macrophages, granulocytes, mast cells, etc. Immune cells can be divided into many types. Various immune cells play an important role in the human body, and their functions cannot be ignored. In order to study the function of immune cells, an important experiment is to clear immune cells in vivo, so it is important to develop animal models that can specifically clear immune cells. The diphtheria toxin receptor-diphtheria toxin (DTR-DT) system is developed in recent years. developed a system for inducing apoptosis in specific cell populations. Diphtheria toxin (DT) is a t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/90C12N15/12A01K67/027G01N33/569
CPCC12N15/8509C12N15/907C07K14/485A01K67/0278G01N33/56966C12N2800/107A01K2207/15A01K2217/072A01K2227/105A01K2267/03A01K2217/30G01N2469/10G01N2333/70589
Inventor 盛剑鹏
Owner 乾元康安(苏州)生物科技有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More