Prothrombin activator and rapid hemostatic material containing prothrombin activator
A technology of activating factors and prothrombin, which is applied in the field of medical biomaterials, can solve the problems of hemophiliacs who cannot stop bleeding quickly, visceral bleeding, and cannot effectively stop bleeding, etc., achieve safety, non-toxic side effects, prevent secondary bleeding and infection, and significantly The effect of the hemostatic effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0051] The present invention also includes a preparation method of prothrombin activator, comprising the following steps:
[0052] ①Design primers according to the base sequence shown in SED ID NO: 1, and introduce restriction sites at the 5' end primers and 3' end primers respectively. The restriction site of the 5' end primers is Bam HI, 3' The enzyme cutting site of the end primer is Xho I;
[0053] The 5' end primer is GGATCCATGGCTCCTCAACTACTCCT;
[0054] The 3' end primer is CTCGAGTTGAATATATCACTTTTATTCTGTTCC;
[0055] ② Recovery of DNA fragments containing prothrombin activator;
[0056] Cut off the target fragment of the electrophoresis gel under ultraviolet light, put it into a small centrifuge tube, add 100 μL NaI solution (100 μg gel: 100 μL NaI), and then place it in a 55 ° C water bath to dissolve the gel; add 50 μL of glass powder to make DNA is adsorbed on the glass powder, so that the DNA is separated from the agarose gel, placed at 25°C for 15 minutes, and ce...
Embodiment 1
[0094] A prothrombin activator, the cDNA sequence of which is the base sequence shown in SED ID NO:1.
[0095] A preparation method of prothrombin activator, comprising the following steps:
[0096] ①Design primers according to the base sequence shown in SED ID NO: 1, and introduce restriction sites at the 5' end primers and 3' end primers respectively. The restriction site of the 5' end primers is Bam HI, 3' The enzyme cutting site of the end primer is Xho I;
[0097] The 5' end primer is GGATCCATGGCTCCTCAACTACTCCT;
[0098] The 3' end primer is CTCGAGTTGAATATATCACTTTTATTCTGTTCC;
[0099] ② Recovery of DNA fragments containing prothrombin activator;
[0100] Cut off the target fragment of the electrophoresis gel under ultraviolet light, put it into a small centrifuge tube, add 100 μL NaI solution (100 μg gel: 100 μL NaI), and then place it in a 55 ° C water bath to dissolve the gel; add 50 μL of glass powder to make DNA is adsorbed on the glass powder, so that the DNA is ...
Embodiment 2
[0125] Except for the following steps, all the other steps are the same as the steps of the preparation method of the prothrombin activator of Example 1, specifically:
[0126] The enzyme digestion time in step ③ is 3.5 hours, recover and purify the enzyme digestion product after 12 hours in step ⑤, incubate in a 30°C incubator for 3 hours, after the incubation is completed, spread the bacteria solution on the plate, and incubate it upside down at 30°C for 4 days to obtain single colony;
[0127] The pH of the medium in step ⑦ is 6.0, and the specific composition is to include 2% tryptone, 1% yeast extract, 1.34% yeast nitrogen base in parts by weight, 4×10 -5 D-vitamins, 1% glycerol, 100 mM phosphate buffer pH 6.0.
[0128] The specific steps of freeze-drying are: pre-freeze the material in a vacuum freeze dryer at -60°C for 6 hours, and carry out sublimation drying at a vacuum degree of 5Pa in the drying chamber at a temperature of 20°C for 10 hours. After sublimation, Rai...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com