Application of INPP5B gene in detection of breast cancer
A breast cancer and gene technology, applied in measurement devices, microbial determination/inspection, instruments, etc., can solve the problems of lack of specific molecular markers, difficulty in diagnosing invasive breast cancer, etc., and achieve the effect of inhibiting cell growth
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Expression of INPP5B in breast cancer tissue and normal breast tissue detected by immunohistochemical technique
[0066] 1. Sample collection: 38 cases of breast cancer tissue and normal breast tissue samples were collected. All the above-mentioned specimens were obtained with the consent of the organizational ethics committee.
[0067] 2. HE staining and immunohistochemical staining for each sample
[0068] The methods of HE staining and immunohistochemical staining can be carried out according to conventional techniques in the art, and the following steps can be adopted:
[0069] HE staining
[0070] 1) Dewaxing and hydration: xylene I: 10min → xylene II: 5min → absolute ethanol I: 5min → absolute ethanol II: 5min → 95% ethanol: 1min → 90% ethanol: 1min → 70% ethanol: 1min
[0071] 2) Hematoxylin staining: 5min, fully rinse with tap water
[0072] 3) Eosin staining: 3-10s, fully rinse with tap water
[0073] 4) Warm water turns blue (the nucleus can be clearly s...
Embodiment 2
[0104] INPP5B RT-PCR quantitative detection
[0105] INPP5B gene Sybergreen RT-PCR quantitative detection primer sequence:
[0106] Forward primer: 5′-CAGAGCCGCCTCCTGGGACT-3′
[0107] Reverse primer: 5'-TGGCCATCCTCCGGTGCGTA-3'
[0108] ACTB gene Sybergreen RT-PCR quantitative detection primer sequence:
[0109] Forward primer: 5′-CACCATTGGCAATGAGCGGTTC-3′
[0110] Reverse primer: 5'-AGGTCTTTGCGGATGTCCACGT-3'
[0111] The relative expression level of INPP5B=INPP5B expression level / ACTB expression level
[0112] Real-time quantitative PCR reaction using Premix Ex TaqTM (Perfect Real Time) kit
[0113](TaKaRa Biotechnology Co., Ltd. Dalian, China) reaction system, using ThermalCycler DiceTMReal Time System (TP800 real-time fluorescent quantitative PCR instrument, TaKaRa) for operation.
[0114] see attached results figure 1 A-B.
Embodiment 3
[0116] INPP5B promoter methylation Methylight-qPCR detection:
[0117] Tissue or cell genomic DNA disulfide experiments refer to Qiagen disulfide kits.
[0118] INPP5B (forward primer-5'GTTTTGGAAGTATGAGGGTGACG-3', probe 6FAM 5'TCTTTCTTAGGCGTGCGTGACGAGGGTAGGCGGGT,
[0119] Reverse Primer - 5'TTCCCGCCGCTATAAATCG-3')
[0120] ACTB (forward primer-5′TGGTGATGGAGGAGGTTTAGTAAGT-3′, probe 6FAM5′ACCACCACCCAACACACAATAACAAACACA-3′TAMRA, reverse primer-5′AACCAATAAAACCTACTCCCTCCCTAA-3′).
[0121] The qPCR reaction refers to the Qiagen kit.
[0122] Calculate Methylation ratio = INPP5B Methylation PCR value / ACTB Methylation PCR value × 1000
[0123] see attached results figure 2 b.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com