Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Procambarus clarkia anti-lipopolysaccharide factor gALF1 gene, coded gALF1 protein thereof and application thereof

A technology for resisting lipopolysaccharide factor and Crayfish is applied in the directions of application, genetic engineering, plant genetic improvement, etc., which can solve the problems of economic loss, death, and disease is not good, and achieves the level of inhibiting replication and strong inhibitory effect. Effect

Active Publication Date: 2020-04-10
HUAZHONG AGRI UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above-mentioned diseases are very fatal to the cultivation of shrimps. Once the cultivated shrimps get sick, it will cause a large area of ​​death. At present, there is no good treatment for the above-mentioned diseases. Therefore, once the shrimps cultivated by farmers get sick, it will cause huge economic loss

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Procambarus clarkia anti-lipopolysaccharide factor gALF1 gene, coded gALF1 protein thereof and application thereof
  • Procambarus clarkia anti-lipopolysaccharide factor gALF1 gene, coded gALF1 protein thereof and application thereof
  • Procambarus clarkia anti-lipopolysaccharide factor gALF1 gene, coded gALF1 protein thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0059] Preparation of gALF1 protein

[0060] ① RNA extraction and reverse transcription:

[0061] Three Procambarus clarkii were selected, blood was drawn and dissected to take tissue samples: hemolymph, heart, liver, gills, stomach, and intestine, and total RNA was obtained by TRIzol method. Nano-Drop 300 was used to detect the purity and concentration of RNA, and the quality of total RNA was analyzed by agarose gel electrophoresis using a Bio-Rad gel imager; cDNA was synthesized by reverse transcription according to the reverse transcription instructions.

[0062] ② ALF1 full-length coding region gene amplification:

[0063] upstream primer

[0064] Pc-ALF1-EcoR I: 5'(TACTCAGAATTCCAGGTCCTGGAGGGTCTG)3';

[0065] downstream primer

[0066] Pc-ALF1-Xhol I: 5'(TACTCA CTCGAGCTACCCATCAAGCCATGCCT) 3'.

[0067] The cDNA obtained by reverse transcription was used as a template for PCR amplification; a 25 μL PCR reaction system was established, and the reaction conditions were: p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discovers procambarus clarkia anti-lipopolysaccharide factor gALF1 gene for the first time and the nucleotide sequence of the gALF1 gene is shown as SEQ ID NO.1. According to the invention, a gALF1 protein is prepared by utilizing the gene coding, and the amino acid sequence of the gALF1 protein is shown as SEQ ID NO.2. The invention also discloses application of the gene and the protein in the field of immunization and treatment of WSSV virus infection. The procambarus clarkia anti-lipopolysaccharide factor gALF1 gene disclosed by the invention has an effective antiviral effectas well as extremely strong inhibiting and killing effects on the WSSV virus; and immune and treatment problems of WSSV virus infection can be solved effectively.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a procambarus clarkii anti-lipopolysaccharide factor gALF1 gene, a gALF1 protein encoded by it and an application thereof. Background technique [0002] Procambarus clarkii, also known as red crayfish or freshwater crayfish, is shaped like a shrimp and has a hard shell; the adult length is about 5.6 to 11.9 cm. Procambarus clarkii is a freshwater economical shrimp, which is widely welcomed by people because of its delicious meat. Because of its omnivorous nature, fast growth rate and strong adaptability, it forms an absolute competitive advantage in the local ecological environment. Its food range includes aquatic plants, algae, aquatic insects, animal carcasses, etc. In recent years, Procambarus clarkii has become an important economic breeding species in my country, with a huge output. [0003] Shrimp white spot syndrome is a complex disease caused by white spot synd...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/435C12N15/70C12N15/66
CPCC07K14/43509C12N15/70
Inventor 兰江风张英豪李通曹晓彤殷成明顾泽茂
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products