Method for preparing and purifying recombinant adenovirus expressing Sox4 gene
A gene recombination and adenovirus technology, applied in the field of genetic engineering, can solve the problems of long establishment time, short overexpression time, and low transfection efficiency of overexpression vector.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] The invention provides a method for preparing and purifying recombinant adenovirus expressing Sox4 gene. Based on the pAdtrack-CMV adenovirus expression vector, the Sox4 gene was introduced to obtain a recombinant adenovirus expressing the Sox4 gene. A large amount of adenovirus was cultured in HEK293 cells, and the virus was purified by cesium chloride gradient centrifugation.
[0033] A preparation method of recombinant adenovirus expressing Sox4 gene
[0034] Step A1, using the mouse Sox4 (NCBI Reference Sequence: NM_009238.2) gene sequence as a template, according to the pAdtrack-CMV vector sequence, select KpnI and HindIII restriction sites to design the sequence, and clone the full-length CDS sequence of Sox4, The primer sequences are as follows:
[0035] Sense: GGGGTACCATGGTACAACAAGACCAACAACG
[0036] Antisense: CCCAAGCTTTCAGTAGGTGAAGACCAGGTTAGA
[0037] Step A2, amplify the Sox4 gene sequence, extract mouse liver tissue RNA, and reverse transcribe it into cD...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com