Droplet digital PCR kit for detecting carp edema virus
A kit and digital technology, applied in the field of inspection and quarantine, can solve the problems of low viral load and missed detection, low sensitivity and low specificity, and achieve the effects of simple operation, good repeatability and good specificity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] The establishment of embodiment 1 carp edema virus ddPCR detection method
[0041] 1.1 Design and synthesis of primers and probes
[0042] Downloaded 88 CEV P4a gene sequences from different sources from GenBank database, used DNAStar software to compare and analyze the sequences, and used Primer Express 3.0 software to design 3 pairs of primers and probe combinations (as shown in Table 1). In addition, a pair of primers for amplification of P4a gene (CEV-P4a-F1 and CEV-P4a-R1, as shown in Table 1) were designed using Primer Premier 5.0 software to prepare standard DNA of CEV P4a gene, whose sequence is shown in SEQ ID NO. .10 shows:
[0043] gttatcaatgaaatttgtgtattgtgtttttgttagtccaagagttttcttttcatcatttgttaccttttgtagttgtttgatatttgtgataagatttccattagcataaaatccttcccaaatttgagttgaaacatgttttagagttttgtatattgtagcatttcctagtttgtatggcaagaaacaaactctctttactgtaactccttgaggaatctgatctagaattccgcaatatgtaatctcaaatttgtttgtggagtttttgaaatatactacttcatcatacaatcctagaactagagcaagattagaagtcattgtct...
Embodiment 2
[0093] The application of embodiment 2 carp edema virus ddPCR detection method
[0094] 54 koi tissue samples and 97 carp tissue samples collected from Beijing, Hebei, Henan, Inner Mongolia, Heilongjiang, Ningxia and Hunan provinces during 2016-2018. Samples were stored at -80°C.
[0095] 2.1. Sample processing
[0096] The DNA of 151 samples was extracted, and the tissue DNA extraction kit (DNeasy Blood & Tissue Kit) of Qiagen was used. All samples were directly divided into packaging after extraction, part of which was used for direct detection, and the other part was stored at -80°C for future use.
[0097] 2.2 Clinical sample testing
[0098] Nucleic acid quantitative detection was performed on clinical samples using the CEV ddPCR detection method established in Example 1, and parallel detection was performed using the optimized CEV qPCR detection method, and the detection coincidence rates of the two methods were compared. The detected reaction conditions and reaction ...
PUM
Property | Measurement | Unit |
---|---|---|
PCR efficiency | aaaaa | aaaaa |
correlation coefficient | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap