Identification method for identifying PGC transplantation offspring chickens by feather color in combination with molecular genetic markers
A technology combining molecular and genetic markers, applied in the determination/inspection of microorganisms, biochemical equipment and methods, animal husbandry, etc., can solve the problems that are difficult to apply, and achieve the effects of strong feasibility, accurate identification, and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0007] The raw materials required in the present invention include: Langshan chicken embryos hatched to 4.5 days, recessive white-feathered chicken embryos hatched to 2.5 days. Gold Mix (Qingke), Genome Extraction Kit (Tiangen), LEI094PCR amplification primers: upstream CAGGATGGCTGTTATGCTTCCA, downstream GACCATACTTCTGGAACAAG.
[0008] Culture fluid: 43.5ml KO-DMEM medium, 5% FBS (volume concentration), 1% chicken serum (volume concentration), 1% penicillin streptomycin (volume concentration), 0.4% non-essential amino acid (volume concentration), 0.2 μl β-mercaptoethanol, 100 μl hSCF (5 ng / ml), 100 μl bfgf (10 ng / ml), 50 μl LIF.
[0009] An identification method for identifying PGC transplanted offspring chickens through feather color combined with molecular genetic markers, the specific method is as follows:
[0010] (1) Separate the genital ridges of Langshan chicken embryos hatched to 4.5 days under a stereomicroscope, digest with trypsin for 3 minutes, add culture medium t...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com