Multiple PCR detection kit for Listeria monocytogenes and Listeria illichii
A technology for monocytogenes and Listeria ii, applied in biochemical equipment and methods, measurement/inspection of microorganisms, microorganisms, etc., can solve cumbersome operations, Listeria monocytogenes and Listeria To solve the problems such as the complexity of bacteria detection, to achieve the effect of speeding up the detection speed, simple result judgment and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1: Establishment of Multiplex PCR Detection Method for Listeria monocytogenes and Listeria izii
[0041] 1) Primers
[0042] Download the whole genome sequences of Listeria monocytogenes and Listeria izini from Genebank, and finally determine two specific target genes, lmo0601 and smcl, whose nucleotide sequences are shown in SEQ ID NO: 5 and 6, respectively shown. The conserved regions of the two target genes were found respectively, and primers were designed. The sequences of the two pairs of detection primers and the lengths of the corresponding amplification products are shown in Table 1.
[0043] Table 1 Primers for multiplex PCR detection of Listeria monocytogenes and Listeria izii
[0044]
[0045] SEQ ID NO: 5 (lmo0601 nucleotide sequence):
[0046] atgcataaacatcacttaagcaaaaaactatttttcgctggtttggtactatttattattggtgctatcggtgtagcattcacaatgaatacaggtaaaatgattgaaaaaggagaaccacttacaaaacagtgggacttatcaactgaaaatattaaaaaaattgctttttcttccgagcgtgatgcatcaattgaatgg...
Embodiment 2
[0071] The preparation of embodiment 2 kit
[0072] Gene lmo0601 detection primers and gene smcl detection primers were synthesized respectively, see Table 1 for details.
[0073] The above primers can be individually packaged or packaged separately, and the amount thereof can be used in a conventional amount known to those skilled in the art.
[0074] That is to say, the kit of the present invention may contain each set of primer pairs individually packaged above, or may contain a configured PCR detection mixture containing each set of primers.
[0075] Further, the above kit may also include other conventional reagents required for PCR, such as: one or more of common PCR reagents such as ddH2O, dNTP, PCR buffer, rTaq enzyme, sample genomic DNA extraction reagents, etc.
Embodiment 3
[0076] Example 3: Multiplex PCR Identification of Bacterial Cultures in Pork Samples
[0077] Using the multiplex PCR method established by the present invention, carry out multiplex PCR identification on 37 suspected Listeria strains isolated from pork samples recently, and at the same time refer to the biochemical identification method in GB 4789.30-2016 to conduct multiplex PCR identification results verify. The strain information is shown in Table 3.
[0078] Table 3 Listeria monocytogenes isolates in pork samples
[0079]
[0080]
[0081] The extraction method of bacterial strain genome template was carried out according to the method of conventional bacterial DNA extraction kit. Use the kit in Example 2 to amplify the DNA: Add 12.5 μL 2×Taq Master mix, 1 μL genomic DNA template, 10 μM primers lmo0601F, lmo0601R, smclF and smclR to each small PCR tube, and use ddH 2 O was made up to 25 μL and mixed, and a negative control was set at the same time. After the mul...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com