PCDR (polymerase chain displacement reaction) detection reagent for food-borne pathogenic bacterium listeria monocytogenes
A technology for Listeria monocytogenes and food-borne pathogenic bacteria, applied in the direction of DNA/RNA fragments, recombinant DNA technology, and microbial-based methods, can solve problems such as no public reports, and achieve significant economic and social benefits. Benefits, ease of use, and the effect of ensuring food safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0011] The specific implementation of the present invention will be described in detail below in combination with specific situations.
[0012] A kind of detection reagent of food-borne pathogen Listeria monocytogenes PCDR method of the present invention is made of following components: SD buffer solution 100mL, dNTPs 2.5mmol, Mg2+ 3mmol, 1 pair of internal primers, including internal upstream and downstream primers 400nmoL, 1 outer primer, including 200nmoL each of outer upper and lower primers, SD DNA polymerase 80U, add ultrapure water to 1000mL and mix well;
[0013] The nucleotide sequences of the 1 pair of inner primers are SEQ ID No:3 (LM-1 (NO.1044-1063), CGGAGGTTCCGCAAAAGATG) and SEQ ID No:4 (LM-2 (NO.1277-1258), The primer of CCTCCAGAGTGATCAATATT) comes from the hemolysin gene of food-borne pathogen Listeria monocytogenes;
[0014] The nucleotide sequence of said 1 outer primer, SEQ ID No: 1 (F1 (NO.820-841), GTTACTAAAGAGCAGTTGCAAG) and SEQ ID No: 2 (R1 (NO. 1462-16...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com