Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

PCDR (polymerase chain displacement reaction) detection reagent for food-borne pathogenic bacterium listeria monocytogenes

A technology for Listeria monocytogenes and food-borne pathogenic bacteria, applied in the direction of DNA/RNA fragments, recombinant DNA technology, and microbial-based methods, can solve problems such as no public reports, and achieve significant economic and social benefits. Benefits, ease of use, and the effect of ensuring food safety

Pending Publication Date: 2019-08-27
ZHENGZHOU UNIVERSITY OF LIGHT INDUSTRY
View PDF17 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The present invention mainly studies the detection of Listeria monocytogenes by the PCDR method, designs two pairs of nested primers for the target gene, and explores the reaction system, and provides a food-borne pathogenic bacteria Listeria monocytogenes PCDR method detection Reagents and detection methods are given, but no public reports have been seen so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCDR (polymerase chain displacement reaction) detection reagent for food-borne pathogenic bacterium listeria monocytogenes
  • PCDR (polymerase chain displacement reaction) detection reagent for food-borne pathogenic bacterium listeria monocytogenes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] The specific implementation of the present invention will be described in detail below in combination with specific situations.

[0012] A kind of detection reagent of food-borne pathogen Listeria monocytogenes PCDR method of the present invention is made of following components: SD buffer solution 100mL, dNTPs 2.5mmol, Mg2+ 3mmol, 1 pair of internal primers, including internal upstream and downstream primers 400nmoL, 1 outer primer, including 200nmoL each of outer upper and lower primers, SD DNA polymerase 80U, add ultrapure water to 1000mL and mix well;

[0013] The nucleotide sequences of the 1 pair of inner primers are SEQ ID No:3 (LM-1 (NO.1044-1063), CGGAGGTTCCGCAAAAGATG) and SEQ ID No:4 (LM-2 (NO.1277-1258), The primer of CCTCCAGAGTGATCAATATT) comes from the hemolysin gene of food-borne pathogen Listeria monocytogenes;

[0014] The nucleotide sequence of said 1 outer primer, SEQ ID No: 1 (F1 (NO.820-841), GTTACTAAAGAGCAGTTGCAAG) and SEQ ID No: 2 (R1 (NO. 1462-16...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a PCDR (polymerase chain displacement reaction) detection reagent for food-borne pathogenic bacterium listeria monocytogenes, which can effectively realize quick and accuratedetection of the food-borne pathogenic bacterium listeria monocytogenes by a high-sensitive PCDR method. The PCDR detection reagent is prepared by an SD buffer solution, dNTPs, Mg<2+>, one pair of upstream and downstream inner primers, one pair of upstream and downstream outer primers and SD DNA polymerase through uniformly mixing by adding ultrapure water; when being used, the genomic DNA of thelisteria monocytogenes is dissolved in ddH2O, the DNA and the detection reagent provided by the invention are taken to be mixed and are uniformly mixed in an EP tube; the reaction tube is placed in aPCR (polymerase chain reaction) amplifier for reaction, predegeneration, annealing and extending, the steps are cycled, then agarose gel electrophoresis detection is performed, thereby realizing the detection of the food-borne pathogenic bacterium listeria monocytogenes by the PCDR method. The detection reagent provided by the invention is scientific and reasonable in components, easy to produce and prepare, convenient to use, and can quickly detect the food-borne pathogenic bacterium listeria monocytogenes with sensitivity and specificity, so as to ensure the food safety and realize obvious economic and social benefits.

Description

technical field [0001] The invention relates to the field of food safety, in particular to a reagent for detecting food-borne pathogenic bacteria Listeria monocytogenes by PCDR method. Background technique [0002] With the vigorous development of the food industry, the types and quantities of food are increasing, especially in recent years, frequent food safety incidents caused by food-borne pathogens have sounded the alarm for people time and time again, and it is more and more urgent to Efficient, rapid and accurate detection of sexual pathogenic bacteria. The traditional detection method of foodborne pathogen Listeria monocytogenes (i.e. Listeria monocytogenes) involves pre-enrichment, selective isolation and culture, biochemical experiments and serological identification. cumbersome, low specificity and many other shortcomings. Therefore, the country has always attached great importance to the research on the detection of food-borne pathogens, hoping to find a detecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/686C12Q1/689C12Q1/04C12N15/11C12R1/01
CPCC12Q1/686C12Q1/689C12Q2531/119
Inventor 孙新城白艳红张靖楠张勇景建洲胡金强赵电波高辉耿尧张华侯佩
Owner ZHENGZHOU UNIVERSITY OF LIGHT INDUSTRY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products