Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-pathogenicity H7N9 avian influenza virus antigen with low receptor binding activity and preparation method of antigen

An avian influenza virus, highly pathogenic technology, applied in the field of virus genetic engineering, can solve the problems of receptor affinity results, low receptor binding activity, etc., to improve accuracy, improve biological safety, and reduce HA protein receptors The effect of binding affinity

Inactive Publication Date: 2019-08-09
GUANGZHOU MEDICAL UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The second object of the present invention is to provide a HPAI H7N9 influenza virus antigen with low receptor binding activity, so as to solve the problem of the influence of the change of receptor affinity on the result in the HI test

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-pathogenicity H7N9 avian influenza virus antigen with low receptor binding activity and preparation method of antigen
  • High-pathogenicity H7N9 avian influenza virus antigen with low receptor binding activity and preparation method of antigen
  • High-pathogenicity H7N9 avian influenza virus antigen with low receptor binding activity and preparation method of antigen

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Method for Reducing HPAI H7N9 Influenza Virus Receptor Binding Affinity

[0037] The first step is to synthesize the HA gene: first, according to the HA gene sequence of the HPAI H7N9 influenza vaccine strain A / Guangdong / 17SF003 / 2016 (H7N9) recommended by WHO, synthesize the HA gene with multiple basic amino acid deletions at the cleavage site, the cleavage site The HA gene (called H7 / GD16 / WT) with multiple basic amino acid deletions was completed by GenScript. Existing studies have shown that the cleavage site with multiple basic amino acids is a sign of highly pathogenic avian influenza virus, and the deletion of multiple basic amino acids can reduce its pathogenicity, so that the recombinant virus can be tested in the biosafety level two experiment. The operation is carried out in the room without affecting the immunogenicity of the HA protein. For the sake of safety, the cleavage site in the HA gene of the HPAI H7N9 influenza vaccine strain, which has the character...

Embodiment 2

[0052] The difference between embodiment 2 and embodiment 1 lies in the site-directed mutation of the HA gene and the virus recombination process: in embodiment 2, the arginine (R) at the 229 position of the HA protein is first mutated into isoleucine (I), and then Then mutate the arginine (R) at position 220 of the HA protein to glycine (G);

[0053] First, the arginine (R) at position 229 of the receptor binding region (encoded according to the H3 sub-HA sequence, corresponding to the H7 coding sequence at position 238) is mutated into isoleucine (I) to prepare the recombinant plasmid pM- H7 / GD16 / R229I; then perform site-directed mutation on the recombinant plasmid pM-H7 / GD16 / R229I, mutate the arginine (R) at position 220 of the HA protein to glycine (G), and the site-directed mutagenesis primers:

[0054] R220G-F: CGAGTCCAGGAGCAGGACCACAAGTTAATG, corresponding to SEQ ID NO.6 in the sequence listing;

[0055] R220G-R: CATTAACTTGTGGTCCTGCTCCTGGACTCG, corresponding to SEQ ID N...

Embodiment 3

[0061] The difference between Example 3 and Example 1 is that the NA segment in Example 3 is selected from N9NA gene with non-oseltamivir resistance mutation. The NA gene containing the oseltamivir resistance mutation has the effect of resistance to oseltamivir, and the HPAI H7N9 influenza virus prepared by using this mutated NA gene has the risk of drug-resistant gene proliferation. By using non-oseltamivir The drug-resistant mutated NA gene can prevent the oseltamivir drug-resistant mutated NA gene from spreading influenza virus widely. The process of synthesizing HA gene of H7 / GD16 / WT, constructing pM-H7 / GD16 / WT recombinant plasmid, site-directed mutagenesis of HA gene and rescuing virus in Example 3 is the same as in Example 1 above.

[0062] In the first step, the NA gene of the LPAI H7N9 vaccine strain A / Anhui / 1 / 2013 (H7N9) (GISAIDID: EPI439509, called N9 / AH13) was selected as the NA gene. N9 / AH13 was completed by GenScript, and N9 / AH13 The sequence of is shown in SEQ I...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a high-pathogenicity H7N9 avian influenza virus antigen with low receptor binding activity and a preparation method of the antigen. The method comprises the following steps ofpreparation of a mutant HA gene, wherein a gene sequence of mutant high-pathogenicity H7N9 avian influenza virus full-length HA protein is prepared, and the R229I mutant HA gene is obtained, and the sequence of the R229I mutant HA gene is shown in SEQ ID NO.2; virus rescue, wherein the R229I mutant HA gene is adopted for rescuing a recombinant influenza virus. According to the prepared recombinanthigh-pathogenicity H7N9 avian influenza virus, arginine located at the 229 locus in a receptor binding area is mutated into isoleucine, and the receptor binding affinity of the HA protein is reduced.

Description

technical field [0001] The invention relates to the field of virus genetic engineering, in particular to a highly pathogenic H7N9 avian influenza virus antigen with low receptor binding activity and a preparation method thereof. Background technique [0002] Influenza A virus (influenza A virus) is a representative species of Orthomyxoviridae. According to the objects infected by influenza viruses, viruses can be divided into human influenza viruses, swine influenza viruses, equine influenza viruses, and avian influenza viruses. According to the difference of hemagglutinin protein (HA protein) and neuraminidase (NA), influenza A virus can be further divided into different HA subtypes (H1-H18) and NA subtypes (N1-N11). When people or animals are infected with the virus, it may cause influenza pandemic, and even cause death of people or animals in severe cases. [0003] In March 2013, a new type of H7N9 subtype influenza virus that first appeared in the world caused an epide...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/44C07K14/11C12N15/85C12N15/66
CPCC07K14/005C12N15/66C12N15/85C12N2760/16022
Inventor 王洋陈凌潘蔚绮吕云华董记
Owner GUANGZHOU MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com