PDCoV detection method based on real-time fluorescence RT (reverse transcription) RAA (recombinase-aid amplification) technology
A real-time fluorescence, coronavirus technology, applied in the field of pig delta coronavirus detection, can solve the problems of inaccurate and reliable detection results, aerosol pollution, etc., and achieve the effect of low cost and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0038] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments, and the schematic embodiments and descriptions of the present invention are used to explain the present invention, but are not intended to limit the present invention.
[0039] 1 Materials and methods
[0040] 1.1 Preparation of dsRNA positive standard
[0041] Use TGuide Total Nucleic Acid Extraction Viral DNA / RNA Kit and Automatic Nucleic Acid Extractor to extract PDCoV virus (Genebank No.KY 363868.1) RNA from pig testicular cells cultured and isolated in our laboratory as template RNA. According to the N gene sequence published by PDCoV in GenBank, design RT-PCR primers:
[0042] Upstream primer: 5`~GCTACTCATCCTCAGTTTCGTG~3`;
[0043] Downstream primer: 5`~ACGCTGCTGATTCCTGCT~3`;
[0044] Using One Step PrimeScript TM RT-PCR Kit (TAKARA Company), the reaction system was established according to the instructions, and the primers were used...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com