Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Ad4/Ad7 type bivalent recombinant adenovirus and application thereof

A technology of recombinant adenovirus and adenovirus, applied in the direction of double-stranded DNA virus, application, virus, etc., can solve the problem of no adenovirus vaccine and so on

Active Publication Date: 2019-03-22
ACADEMY OF MILITARY MEDICAL SCI
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In my country, outbreaks of concentrated adenovirus infection are also reported from time to time. The infected people are mainly soldiers with reduced immunity after intensive training and the elderly and children with relatively low immunity. There are also reports of deaths among adenovirus-infected people. There is currently no adenovirus vaccine available

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ad4/Ad7 type bivalent recombinant adenovirus and application thereof
  • Ad4/Ad7 type bivalent recombinant adenovirus and application thereof
  • Ad4/Ad7 type bivalent recombinant adenovirus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1, the preparation of recombinant adenovirus

[0033]1. Construction of recombinant plasmids

[0034] The recombinant plasmid pBRAd4-Ad7E3 is a circular plasmid, which consists of the following three segments from upstream to downstream: the segment shown in sequence 1 of the sequence listing, the genomic DNA of the recombinant adenovirus and the segment shown in sequence 2 of the sequence listing .

[0035] Compared with the wild-type adenovirus DNA (GenBank: AY594253.1, linear VRL 03-FEB-2005), the genomic DNA of the recombinant adenovirus has only the following three mutations (the positions refer to the positions of the wild-type adenovirus) : ① the 1st to 8th nucleotides were mutated from "ctatctat" to "CATCATCA"; ② the 35983-35990th nucleotides were mutated from "atagatag" to "TGATGATG"; Hexon fifth hypervariable region) replaced "gacagcaaaactattgttgctaactacgatccagatattgtaatgtacacagaaaat" (encoding fifth hypervariable region of adenovirus type 4 hexon...

Embodiment 2

[0050] Embodiment 2, Morphology observation of recombinant adenovirus

[0051] Cultivate A549 cells until the degree of confluence reaches 80% to 90%, then infect the P5 generation virus liquid of Ad4-Ad7E3 recombinant adenovirus prepared in Example 1 or the P5 generation virus liquid of Ad4 adenovirus, MOI=1, and cultivate at 37°C until CPE After reaching 80%, the cells at the bottom of the dish were scraped, transferred to a centrifuge tube, centrifuged at 1000rpm at room temperature for 10min, the supernatant was discarded, the precipitate was washed with PBS buffer, then fixed with 3% glutaraldehyde solution at 4°C for 3h, and then ultra- Thin section and electron microscope ultramicroscopic observation.

[0052] see photos Figure 4 . The Ad4-Ad7E3 recombinant adenovirus particles are arranged in a honeycomb shape with a uniform size, which is similar to that of the wild-type Ad4 adenovirus.

Embodiment 3

[0053] Example 3, Cell Immunofluorescence Experiment of Ad7E3 Epitope of Recombinant Adenovirus Ad4-Ad7E3

[0054] The tested virus fluids were the P5 virus fluids of the Ad4-Ad7E3 recombinant adenovirus prepared in Example 1, the P5 virus fluids of the Ad4 adenovirus, and the P5 virus fluids of the Ad7 adenovirus.

[0055] 1. Take a 24-well plate, put an alcohol-sterilized coverslip into each well before plating, and add 500 μL of A549 cell suspension (containing 1×10 4 cells), and the cells adhered to the wall overnight.

[0056] 2. After completing step 1, take the 24-well plate, and add 10 μL of the test virus solution (containing 10 3 PFU virus), placed at 37°C 5% CO 2 Observe and cultivate in the incubator for 2-3 days until the cells appear mild lesions.

[0057] 3. After completing step 2, discard the supernatant, add 100% pre-cooled methanol, fix the cover slip for 15 min, and then wash with PBS buffer 3 times (5 min each time).

[0058] 4. After completing step 3...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an Ad4 / Ad7 type bivalent recombinant adenovirus and application thereof. The invention provides the recombinant adenovirus, which is characterized in that compared with the genomic DNA of a human type 4 adenovirus, the genomic DNA of the recombinant adenovirus only undergoes the following three mutations: 1, the first to eighth nucleotides mutate into 'CATCATCA' from 'ctatctat'; 2, the 35983th-35990th nucleotides mutate into 'TGATGATG' from 'atagatag'; 3, replacing DNA molecules for encoding a fifth hypervariable region of an adenovirus type 4 hexon with DNA molecules for encoding a fifth hypervariable region of an adenovirus type 7 hexon. The invention has a great application value for the prevention and control of Ad4 adenovirus and Ad7 adenovirus.

Description

technical field [0001] The invention relates to an Ad4 / Ad7 type bivalent recombinant adenovirus and its application. Background technique [0002] Adenoviruses are icosahedral, non-enveloped, double-stranded DNA viruses. Adenoviruses are divided into seven groups A-G, among them, human adenovirus type 4 Ad4 is a group E adenovirus, which mainly causes acute febrile respiratory infection and pneumonia, and human adenovirus type 7 Ad7 is a group B adenovirus, which is an important virus that causes acute respiratory diseases in humans. pathogen. [0003] The U.S. company Wyeth (Weyth) developed live vaccines for adenovirus types 4 and 7, and began oral inoculation in 1970 in boot camps that were susceptible to adenovirus infection and caused acute respiratory infections, and hundreds of thousands of people were immunized The results show that the vaccine has a good immune protection effect, and the adenovirus-related respiratory infection disease has decreased by 5.5 times; ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/861A61K39/295A61K39/235A61P31/20
CPCA61K39/12A61K2039/5254A61K2039/70A61P31/20C12N7/00C12N15/86C12N2710/10011C12N2710/10034C12N2710/10043
Inventor 李山虎王芃杨嬉春
Owner ACADEMY OF MILITARY MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com