A method for regulating osmotic stress in Torulopsis glabrata
A smooth spherical Torulopsis and osmotic pressure technology, applied in the field of bioengineering, can solve the problems of decreased cell viability and production capacity, increased osmotic pressure of fermentation system, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: Construction of Deletion Strains
[0029] Using the genome of wild-type Toruula glabrata Candida glabrata ATCC 2001 as a template, P1 / P2, P3 / P4, and P5 / P6 were used as primers to amplify the left arm (L) and histidine gene ( M) and the right arm (R), the knockout box CgRDS2-LMR was constructed by fusion PCR ( figure 1 ). The knockout frame with correct sequencing was introduced into the starting strain Candida glabrata HTUΔ by electric shock transformation method, the positive transformants were screened by histidine marker gene, and the genome was extracted for PCR sequencing verification. The strain with the correct verification result was the deletion strain Cgrds2Δ.
[0030] P1: ATTCGAAGGCCCACTGTA
[0031] P2: ACCCTCTTAACAAACGCCATGTCAAAAATATGATGCTGTGCTTAG
[0032] P3: CACAGCATCATATTTTTTGACATGGCGTTTGTTAAGAGGGT
[0033] P4: ACTTGTCTATGCATATGTGTCTATGCTAGGACACCCTTAGT
[0034] P5: CTAAGGGTGTCCTAGCATAGACACATATGCATAGACAAGTTATATACA
[0035] P6: CCACTATTAGT...
Embodiment 2
[0036] Embodiment 2: Construction of overexpression strain
[0037] The genome of wild-type Toruula glabrata Candida glabrata ATCC 2001 was used as a template, and the target gene CgRDS2 was amplified with P7 / P8 primers. The amplified product and plasmid pY26 were digested with the same restriction enzymes NotI and BglII, and connected by T4 The enzyme connects the gene CgRDS2 to pY26, driven by the strong promoter P TEFInitiate transcription, use the URA3 gene on the recombinant plasmid to screen positive transformants, and finally extract the plasmid to verify that the overexpression strain Cgrds2Δ / CgRDS2 ( figure 2 ).
[0038] P7: AAGGAAAAAAGCGGCCGCATGGAAGAACCAGCAGC
[0039] P8: GGAAGATCTTTAGTTGGAATGATCTCTTGTAGGA
Embodiment 3
[0040] Embodiment 3: the mensuration of each bacterial strain growth performance
[0041] (1) Plate growth experiment: inoculate a single colony of the strain to be tested in 20 mL of YNB (0.67% YeastNitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, then transfer to YNB medium and cultivate until After several phases, measure the bacterial concentration and adjust the bacterial suspension to OD 660 = 1.0, using this as the initial concentration, carry out 5 times of 10-fold gradient dilution, sequentially plant 4 μ L of bacterial liquid on the corresponding solid YNB medium, cultivate at 30 ° C for 2-3 days, observe the growth of the bacteria and take pictures ( image 3 ).
[0042] (2) Growth curve test: inoculate a single colony of the strain to be tested in 20 mL of YNB (0.67% Yeast Nitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, and then transfer to 100 mL of YNB or containing 1.5 In the YNB liqu...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com