Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for regulating osmotic stress of Pseudomonas glabrata

A smooth spherical Torulopsis and osmotic pressure technology, applied in the field of bioengineering, can solve the problems of decreased cell viability and production capacity, increased osmotic pressure of fermentation system, etc.

Active Publication Date: 2019-01-25
JIANGNAN UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the process of fermentation and production of organic acids, the accumulation of extracellular organic acids will cause the pH of the medium to drop. In order to maintain the pH of the fermentation system in the optimum range, it is necessary to feed NaOH and CaCO 3 However, the addition of such substances will increase the osmotic pressure of the fermentation system, resulting in a decrease in cell viability and production capacity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for regulating osmotic stress of Pseudomonas glabrata
  • Method for regulating osmotic stress of Pseudomonas glabrata
  • Method for regulating osmotic stress of Pseudomonas glabrata

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Construction of Deletion Strains

[0029] Using the genome of wild-type Toruula glabrata Candida glabrata ATCC 2001 as a template, P1 / P2, P3 / P4, and P5 / P6 were used as primers to amplify the left arm (L) and histidine gene ( M) and the right arm (R), the knockout box CgRDS2-LMR was constructed by fusion PCR ( figure 1 ). The knockout frame with correct sequencing was introduced into the starting strain Candida glabrata HTUΔ by electric shock transformation method, the positive transformants were screened by histidine marker gene, and the genome was extracted for PCR sequencing verification. The strain with the correct verification result was the deletion strain Cgrds2Δ.

[0030] P1: ATTCGAAGGCCCACTGTA

[0031] P2: ACCCTCTTAACAAACGCCATGTCAAAAATATGATGCTGTGCTTAG

[0032] P3: CACAGCATCATATTTTTTGACATGGCGTTTGTTAAGAGGGT

[0033] P4: ACTTGTCTATGCATATGTGTCTATGCTAGGACACCCTTAGT

[0034] P5: CTAAGGGTGTCCTAGCATAGACACATATGCATAGACAAGTTATATACA

[0035] P6: CCACTATTAGT...

Embodiment 2

[0036] Embodiment 2: Construction of overexpression strain

[0037] The genome of wild-type Toruula glabrata Candida glabrata ATCC 2001 was used as a template, and the target gene CgRDS2 was amplified with P7 / P8 primers. The amplified product and plasmid pY26 were digested with the same restriction enzymes NotI and BglII, and connected by T4 The enzyme connects the gene CgRDS2 to pY26, driven by the strong promoter P TEFInitiate transcription, use the URA3 gene on the recombinant plasmid to screen positive transformants, and finally extract the plasmid to verify that the overexpression strain Cgrds2Δ / CgRDS2 ( figure 2 ).

[0038] P7: AAGGAAAAAAGCGGCCGCATGGAAGAACCAGCAGC

[0039] P8: GGAAGATCTTTAGTTGGAATGATCTCTTGTAGGA

Embodiment 3

[0040] Embodiment 3: the mensuration of each bacterial strain growth performance

[0041] (1) Plate growth experiment: inoculate a single colony of the strain to be tested in 20 mL of YNB (0.67% YeastNitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, then transfer to YNB medium and cultivate until After several phases, measure the bacterial concentration and adjust the bacterial suspension to OD 660 = 1.0, using this as the initial concentration, carry out 5 times of 10-fold gradient dilution, sequentially plant 4 μ L of bacterial liquid on the corresponding solid YNB medium, cultivate at 30 ° C for 2-3 days, observe the growth of the bacteria and take pictures ( image 3 ).

[0042] (2) Growth curve test: inoculate a single colony of the strain to be tested in 20 mL of YNB (0.67% Yeast Nitrogen Base without Amino Acids, 2% Glucose) liquid medium for overnight activation, and then transfer to 100 mL of YNB or containing 1.5 In the YNB liqu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for regulating osmotic pressure stress of Pseudomonas glabrata, belonging to the field of bioengineering. The invention regulates the osmotic stress resistance of Pseudomonas glabrata by overexpressing or deleting the coding gene CgRDS2 of the native transcription factor. The results showed that the biomass, cell viability and membrane integrity of Pseudomonas glabrata decreased by 23%, 46% and 47.6%, respectively, under osmotic stress compared with wild-type strain after the deletion of CgRDS2 gene. After overexpression of CgRDS2 gene, the biomass increased by10%, cell viability increased by 39% and cell membrane integrity increased by 12.1% under 1.5 M NaCl stress.

Description

technical field [0001] The invention relates to a method for regulating the osmotic stress of Torulopsis glabrata, belonging to the field of bioengineering. Background technique [0002] As the only industrial microorganism that produces pyruvate, Torulopsis glabrata is also used to produce other organic acids, such as malic acid, fumaric acid, α-ketoglutaric acid, etc. In the process of fermentation and production of organic acids, the accumulation of extracellular organic acids will cause the pH of the medium to drop. In order to maintain the pH of the fermentation system in the optimum range, it is necessary to feed NaOH and CaCO 3 However, the addition of such substances will continuously increase the osmotic pressure of the fermentation system, resulting in a decrease in cell viability and production capacity. Therefore, osmotic stress is an urgent problem to be solved in the process of fermentative production of organic acids by Torulopsis glabrata. At present, the m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12P7/40C12R1/88
CPCC07K14/39C12P7/40
Inventor 刘立明吴承晋
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com