Multiple liquid-phase chip detection method for swine viral diarrhea pathogens and construction of multiple liquid-phase chip detection method
A technology for swine viral diarrhea and liquid phase chip detection, which is applied to the multiple liquid phase chip detection method and construction field of porcine viral diarrhea pathogens, and can solve the problem of poor probe specificity, increased test errors, and increased uncertain factors, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0096] The construction of the multiple liquid phase chip detection method of embodiment 1 porcine viral diarrhea pathogen comprises the following steps:
[0097] 1. Primer design and modification
[0098] First, use Oligo7 software to analyze 11 viral diarrhea pathogens in pigs, namely PEDV, TGEV, PDCoV, PoRV, BVDV, PSV, PKV, PAstV, PToV, PTV and PSaV, design PCR primers, and screen for suitable TAG sequences;
[0099] The sequences of the PCR primers of 11 kinds of viral diarrhea pathogens of pigs are respectively as follows:
[0100] PToV upstream primer: AATTGCTTATTGGTGGCTTC;
[0101] Downstream primer: AGCDATTTGRGCDGCATTC;
[0102] PDCoV upstream primer: CGCAGTTTTCATTGTGTCCA;
[0103] Downstream primer: CCTGTGGCGGATTTCTAACT;
[0104] PAstV upstream primer: CCTTWCCCCACTGATGAAGA;
[0105] Downstream primer: CCTGTCCATCTGCCTTTCTGT;
[0106] PKoV upstream primer: CGCCGTTCACTCTTTGTCC;
[0107] Downstream primer: ACCAAGCAGCATCCTACCAG;
[0108] PSV upstream primer: CTGGACTG...
Embodiment 2
[0167] Example 2 Liquid-phase chip detection and analysis of clinical porcine viral diarrhea samples
[0168] Using the liquid phase chip detection method in Example 1, 173 parts of porcine diarrhea feces samples were detected, and a negative control was set up in the detection, and carried out in a duplicate hole mode to obtain two groups of data in parallel experiments, and the average value of the two groups of data was taken, and each Data analysis was performed on each sample, and one of the samples was taken as an example. See Table 3 for the two groups of MFI values and negative control values obtained from the detection.
[0169] 1. The qualitative analysis process is as follows:
[0170] 12#xTAG microspheres: sample cMFI=[MFI(sample)-MFI(negative control)] / MFI(negative control)=0.99<3, PoRV negative;
[0171] 14#xTAG microspheres: sample cMFI=[MFI(sample)-MFI(negative control)] / MFI(negative control)=0.15<3, PSV negative;
[0172] 19#xTAG microspheres: sample cMF...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com