An ELISA kit for detecting goose Astrovirus antibody and its preparation method
A technology of astroviruses and kits, applied in the fields of biotechnology and animal infectious disease diagnosis and research, can solve problems such as difficult popularization and application, and achieve the effects of fast methods, high sensitivity, and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Preparation of Goose Astrovirus (Avian Astrovirus Type 3) Recombinant Protein
[0037] 1. Artificial synthesis of the Cap P2 gene: According to the results of the whole genome sequencing of the GAstV GD strain in our laboratory, the codon of the Cap P2 gene was optimized to make it suitable for expression in E. coli, and restriction enzyme sites were introduced at both ends EcoRV and XhoI, the gene was synthesized by Shanghai Sangon Bioengineering Co., Ltd., the sequence is as follows:
[0038] 5’-GATATCCAGGTTACACCCTCGCTTGTGTACAACTTCCAGGGTGAAAGGCAGAGCACTACAGAATCGTGCTCATTCCTGGTGTTTGGAATACCACAGGCAGAATCCAGGTCAAGATACAATGCAGCTATAACCTTCAATGTTGGCTACCGTGGAAGGACTTCAACATCATTTACACTTGGAACACACAATTGGTGGGCTGTTATGACACTTTCACAAACAGGAGTAATTTTTGCACCACCGGCTGTGGGCACAGGGGTCTGTAATACATTGGCTACAGCCATACAACATTTAAATCCTGAGCTTGAAACAGCAGTCCTGCGTGTGAATACCAGTACAACATCTACTGGTGGGCTAATAACGGAACTCAGGAATCGGCTCAACATCGCTGATGGGGACTATGTGATTTCAATGGGTGATCCGCAAGGAAATAGGTCAGCACTGTACTTTAGGAATTCAGACCAGAAATGGGTGT...
Embodiment 2
[0041] The preparation of embodiment 2 positive control serum, negative control
[0042] Adjust the concentration of the purified Cap P2 recombinant protein to 1 mg / mL with 0.01M PBS (pH7.4), mix it with an equal volume of Freund’s complete adjuvant (Sigma Company), and fully emulsify it with a sonicator (Bandelin Company) (power 30W, 5min); the emulsified recombinant antigen was intramuscularly injected into 10 60-day-old healthy goslings (provided by the National Waterfowl Gene Bank of Jiangsu Agriculture and Animal Husbandry Technology Vocational College), 0.5mL / ; 10 days after the first immunization, Freund's incomplete adjuvant 10 days later, the same dose of recombinant antigen was used to boost immunization once; on the 7th day after the third immunization, goose blood was collected aseptically to separate serum; according to the conventional indirect ELISA method, respectively 2.5 μg / mL Cap P2 protein was recombined to coat the microtiter plate, and after blocking, it ...
Embodiment 3
[0043] Embodiment 3 detects the preparation of goose Astrovirus antibody ELISA kit
[0044] 1. Antibody detection ELISA plate: The kit contains 4 treated 96-well ELISA plates (packed in aluminum foil bags). The ELISA plate treatment process is as follows: Dilute Cap with 0.05M carbonate buffer (pH9.6). P2 recombinant protein to a final concentration of 2.5 μg / mL, add 100 μL to each well of the odd-numbered vertical row of the 96-well plate (sample detection well), add no diluted antigen to each well of the even-numbered vertical row of the 96-well plate (background control well), and statically at 4°C. Set aside for 24 hours, wash twice with washing solution PBST (0.01M PBS, 0.5‰Tween-20, 0.01% Proclin300, pH7.4), add blocking solution (PBST, 5% skimmed milk powder, pH7.6) to each well at 37°C Seal for 2 hours, then wash twice with washing solution PBST, pat off residual water on absorbent paper, air-dry in an ultra-clean workbench, put into an aluminum foil bag (1 microplate / ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap