Supercharge Your Innovation With Domain-Expert AI Agents!

Cell strain capable of expressing glucocerebrosidase with high mannose content as well as preparation method and applications of cell strain

A high mannose and glucose technology, applied in biochemical equipment and methods, other methods of inserting foreign genetic materials, cells modified by introducing foreign genetic materials, etc. High, poor enzyme activity and other problems, to achieve good clinical application prospects, increase drug efficacy, improve the effect of binding ability

Pending Publication Date: 2018-09-28
WUXI BIOLOGICS IRELAND LTD
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the cell line used in the existing method is not high in the content of mannose glycoforms in the glucocerebrosidase, the enzyme activity is relatively poor, and the drug effect is not ideal enough.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell strain capable of expressing glucocerebrosidase with high mannose content as well as preparation method and applications of cell strain
  • Cell strain capable of expressing glucocerebrosidase with high mannose content as well as preparation method and applications of cell strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] The technical solution of the present invention will be clearly and completely described below, obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

[0035] A specific embodiment of the present invention comprises the following steps:

[0036] 1) Design sgRNA according to the key sites of the GNT1 gene sequence, complete the synthesis of sgRNA and primers, and complete the synthesis and extraction of sgRNA / Cas9 plasmid. The sgRNA sequence includes the sequences shown in SEQ ID NO:1 and SEQ ID NO:2:

[0037]CACCGTGACAATGGCAAGGAGCAGA (SEQ ID NO: 1);

[0038] AAACTCTGCTCCTTGCCATTGTCAC (SEQ ID NO: 2).

[0039] 2) Transfect the plasmid synthesized in step 1 into a cell pool stably expressing gl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a cell strain capable of expressing glucocerebrosidase with high mannose content. The preparation method comprises the following steps: (1) carrying outlipofection transfection, namely, aiming at the sequence of a GNT1 gene, designing a sgRNA sequence guiding cutting of endonuclease, recombining the sgRNA sequence into a knock-out vector, thus obtaining synthetic plasmids with coexpression of sgRNA and endonuclease, and transfecting a cell pool stably expressing glucocerebrosidase by adopting the synthetic plasmids through a liposome transfection method; (2) carrying out cloning by adopting a limiting dilution method, namely, screening out monoclonal cells, and carrying out enlarged culturing; (3) carrying out mutation cloning screening on the target gene, namely, acquiring monoclone with the GNT1 gene knocked out through cell PCR sequencing, and thus the cell strain capable of expressing glucocerebrosidase with high mannose content is obtained. The cell strain can stably express glucocerebrosidase, meanwhile, the content of the mannose is obviously improved, the binding capacity with mannose receptor is effectively improved, the enzyme activity capacity is improved, and the purpose of increasing the efficacies is achieved.

Description

technical field [0001] The present invention relates to the field of biopharmaceuticals, in particular to a method for expressing a target protease in CHO (Chinese Hamster Ovary) cells and modifying the glycoform of the product after knocking out the target gene using the gene editing technology CRISPR. Background technique [0002] Deficiency of each enzyme in lysosomes will lead to the accumulation of a specific biomacromolecule in lysosomes that cannot be degraded normally. The common result is that lysosomes swell subsequently, cells become bloated and abnormal, and cell functions are seriously affected, eventually leading to a disease called lysosomal storage disease (Lysosomal storage disease, LSD). Glucocerebrosidosis, a type of LSD, is a family disease of glucose and lipid metabolism. Due to the lack of glucocerebrosidase, a large amount of glucocerebroside is deposited in the liver, spleen, bones, lungs and brain tissues. Accumulates in monocyte-macrophages, eventu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N9/22C12N5/10C12N9/24A61K38/47A61P3/00
CPCA61K38/47A61P3/00C12N9/22C12N9/2402C12N15/907C12Y302/01045
Inventor 陈远汪凤麟蔡洁行周伟昌陈智胜
Owner WUXI BIOLOGICS IRELAND LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More