Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expansion protein and xylanase fusion protein, coding gene and applications thereof

A fusion protein and xylanase technology, which is applied in the fields of genetic engineering technology and biomass utilization, can solve the problems of increasing product separation difficulty and cost, weakening the application prospect of xylo-oligosaccharide, weak recognition ability and binding ability of hemicellulose, etc. , to achieve the effect of improving specific activity, reducing separation difficulty and cost

Active Publication Date: 2018-09-25
NANJING UNIV OF TECH +1
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, xylanase is usually difficult to act on insoluble xylan, and its ability to recognize and bind to hemicellulose is weak, resulting in increased separation difficulty and cost of the product, which seriously weakens the use of xylooligosaccharides in industrial production. application prospects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expansion protein and xylanase fusion protein, coding gene and applications thereof
  • Expansion protein and xylanase fusion protein, coding gene and applications thereof
  • Expansion protein and xylanase fusion protein, coding gene and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] This example illustrates the acquisition method of the expansin EXCL gene of the present invention.

[0025] This example illustrates the procedure for obtaining the expandin EXCL gene and xylanase XYN gene from Bacillus subtilis LC.

[0026] Bacillus subtilis LC was obtained from the preliminary screening of our laboratory, and the strain preservation registration number is CCTCC No: M208073. . The total DNA of Bacillus subtilis LC genome was extracted by the phenol-chloroform method. According to the analysis of the whole gene sequencing results of Bacillus subtilis 168 (NCBI Reference Sequence: CM000487.1), the expansin EXCL gene and xylanase XYN gene were obtained, and the EXCL and XYN amplification primers were designed according to the gene sequence .

[0027] The EXCLF sequence is: GCCG CCATGGG GCATATGACGACCTGCATG

[0028] The EXCLR sequence is: CCG CTCGAG TTCAGGAAACTGAACATGGC

[0029] The XYNF sequence is: GCCG CCATGGG GCTAGCACAGACTACTGGCA

[0030] T...

Embodiment 2

[0034] This example takes the fusion protein EXCL-EK2-XYN (SEQ ID NO: 7) as an example to illustrate the acquisition of the recombinant fusion protein gene, in which EK2 is a rigid linker peptide (EKKKA) n , n=2.

[0035] Using the Bacillus subtilis LC genome as a template, the genes containing expansin EXCL (SEQ.ID.NO.1) and xylanase XYN (Genbank: KX196201, SEQ.ID.NO.2) were amplified. Design EXCL upstream primers and EXCL downstream primers:

[0036] EXCL upstream primer: GCCG CCATGGGC GCATATGACGACCTGCATG;

[0037] EXCL downstream primers:

[0038] TTTAGCCGCAGCTTCTTTTGCCGCAGCTTCTTCAGGAAACTGAACATGGC.

[0039]The upstream primer introduces the restriction endonuclease NcoI site, and the downstream primer introduces the connecting peptide (EAAAK) 2 coding genes. PCR reaction system 50 μL, in which ddH 2 O 20 μL, 10×prime star buffer mix 25 μL, Bacillus subtilis LC genome 1 μL, EXCLF1 and EXCLR1 (20 μM) each 2 μL. Design XYN upstream primers and XYN downstream primers: ...

Embodiment 3

[0045] This example takes the fusion protein EXCL-EK2-XYN as an example to illustrate the construction of the recombinant expression vector pET-EXCL-EK2-XYN and the preparation of recombinant expression transformants.

[0046] The expansin-xylanase (EXCL-EK2-XYN) PCR product was column-purified and then digested with plasmid pET-28a (+) at 37 °C overnight with NcoI and XhoI, and the purified EXCL-EK2- XYN fragment and linear band of pET-28a (+) vector. Next, use T 4 The two fragments were ligated by DNA ligase, ligated overnight at 16°C, and the ligated product was transformed into Escherichia coli BL21(DE3), spread on LB medium containing 100 μg / mL ampicanamycin and cultured overnight at 37°C. The transformant was verified by colony PCR, and the positive transformant was inoculated into liquid LB medium for expansion culture. The culture medium was extracted with the plasmid mini-extraction kit from TAKARA company and identified repeatedly by NcoI and XhoI double enzyme dig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expansion protein and xylanase fusion protein, a coding gene and applications thereof, wherein the expansion protein and xylanase fusion protein comprises an expansion protein EXCL and xylanase XYN, the EXCL is located at the N terminal of the fusion protein, XYN is located at the C terminal of the fusion protein, the amino acid sequence of the expansion protein EXCL isrepresented by SEQ ID NO:2, and the amino acid sequence of the xylanase XYN is represented by SEQ ID NO:4. The invention further provides a preferred method for inserting a linker peptide into the fusion protein. According to the present invention, the expansion protein and xylanase fusion enzyme is constructed by using the gene engineering technology, wherein the enzyme activity is increased by 1.3 times compared to the natural xylanase, and the obtained product can adsorb lignocellulose.

Description

technical field [0001] The invention belongs to the field of genetic engineering technology and biomass utilization, and specifically relates to the application of the fusion protein gene of expansin and xylanase and the integration of fusion protein to produce xylooligosaccharide. Background technique [0002] Corn is widely distributed in my country, with an annual output of more than 100 million tons. Corn cobs generally account for 20.0%~30.0% of the weight of corn ears, and have high hemicellulose content, which is a natural renewable resource. Xylooligosaccharides or xylooligosaccharides are oligosaccharides formed by connecting 2 to 10 xylose molecules with β-1,4 glycosidic bonds. Xylooligosaccharides are difficult to be decomposed by the human digestive enzyme system and can directly enter In the large intestine, on the one hand, it is absorbed and metabolized by the probiotics in the intestine, such as bifidobacteria and lactic acid bacteria, and proliferates in la...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12P19/14
CPCC12N9/248C12P19/14C07K14/32C07K2319/00
Inventor 吴斌韦利军常思源何冰芳储建林
Owner NANJING UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com