ALDH2 (aldehyde dehydrogenase 2) Gene polymorphism detection kit
A site polymorphism and reagent technology, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problems of complicated operation steps and long time-consuming, and achieve high detection specificity and easy operation. , the effect of high conversion rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Embodiment 1, ALDH2 gene polymorphism detection kit and detection method
[0087] 1. ALDH2 Gene Polymorphism Detection Primers
[0088] 1. Design of primers
[0089] According to the rs671 site of the target gene ALDH2 gene, and in order to shorten the amplification time of PCR, the length of the PCR amplification product is controlled at about 150bp, and the following three pairs of primer sequences are designed (the three pairs of primer sequences are all synthesized by Bioserch Company ):
[0090] ALDH2-F1: TTTGGAGCCCAGTCACCCCTTTG;
[0091] ALDH2-R1:AGCCACCAGCAGACCCTCAA;
[0092] ALDH2-F2: TGTTTGGAGCCCAGTCACCCTT;
[0093] ALDH2-R2:AGCCACCAGCAGACCCTCAA;
[0094] ALDH2-F3: TGATGTGTTTGGAGCCCAGTCA;
[0095] ALDH2-R3:AGCCACCAGCAGACCCTCAA.
[0096] Table 2, rs671 site information
[0097]
[0098] 2. PCR amplification
[0099] (1) Phire Hotstart II DNA polymerase for PCR amplification
[0100] Using throat swab liquid samples (ALDH2*1*1 carriers) and the DNA s...
Embodiment 2
[0149] Example 2, Sensitivity Detection of ALDH2 Gene Polymorphism Detection Kit
[0150] Extract DNA from throat swab samples of ALDH2*1*2 carriers, quantify the obtained DNA extract by Nanodrop1000 (Thermo Scientific, ND-1000) and then serially dilute the concentration to 250pg / μL, 125pg / μL, 62.5pg / μL μL, 31.25pg / μL, 15.625pg / μL, 7.8pg / μL, 3.9pg / μL, 1.95pg / μL DNA solution. Then use a pipette gun to draw 2 μL of the above DNA solution and detect the ALDH2 gene polymorphism in DNA solutions with different concentrations according to the method in step 3 of Example 1.
[0151] The result is as Figure 5 shown. The minimum detection DNA content of the ALDH2 gene polymorphism detection kit of the present invention reaches 7.8pg / μL.
Embodiment 3
[0152] Example 3, Application of ALDH2 Gene Polymorphism Detection Kit
[0153] The oral swab samples of 6 patients with angina pectoris (from Beijing Fuwai Hospital, all patients with angina pectoris were confirmed by clinical diagnosis and informed consent) were taken, and the oral swab samples of each patient were divided into two equal parts, and one was used The ALDH2 gene polymorphism detection kit of the present invention detects the genotype of the patient sample to be tested according to the method in Step 3 of Example 1, and another copy is sent to Sanger Sequencing Company for sequencing.
[0154] The test results are shown in Table 7. The melting curve results are as Figure 7 As shown, the sequencing results are as follows Figure 8 shown. As can be seen from the figure and the table: the detection result of the kit of the present invention is consistent with the detection result of the sequencing method, indicating that the kit of the present invention can eff...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap