Lentiviral vector containing CPEB1 gene negative regulation region as well as preparation method and applications of lentiviral vector
A technology of lentiviral vector and negative regulation, which is applied in the field of lentiviral vector and its preparation, can solve the problems of unclear microRNA-122 and its target gene CPEB1, and achieve high transcription efficiency and high infection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] A method for constructing a lentiviral vector comprising a negative regulatory region of the CPEB1 gene, comprising the following steps:
[0031] 1) Amplify the coding sequence of CPEB1 gene from mouse dendritic cells
[0032] According to the gene sequence of CPEB1 on NCBI (NM_030594), primers for its coding sequence were designed:
[0033]Upstream primer (SEQUENCE ID NO:2):
[0034] CTCCCAAGCTTATCGATA GTCCCTTAGGGCCACGC, the underlined part was cloned into the ClaI restriction site of pLVX-IRES-ZsGreen1 by In-Fusion recombination method (Takara).
[0035] Downstream primer (SEQUENCE ID NO:3):
[0036] CTAA GCGATCGC TCAGTTCTTCTGGTTCCTCATTAGG, the underlined part is the SgfI restriction site, which is used to connect with its 3'-UTR fragment. The fragment was amplified by PCR, and the theoretical size was 1760bp. figure 1 For the results of agarose gel electrophoresis detection of CPEB1 amplification products, such as figure 1 It is shown that there is an obviou...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com