Supercharge Your Innovation With Domain-Expert AI Agents!

Over-expressed lentiviral vector of cdtB gene and construction method thereof as well as lentivirus containing cdtB gene and application thereof

A lentiviral vector and gene overexpression technology, applied in the field of lentivirus, can solve the problems of affecting the function of cdtB protein, hindering the progress of cdtB gene research, and difficult to enter cdtB protein

Inactive Publication Date: 2017-12-15
YANGZHOU UNIV
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the structure of the prokaryotic expressed cdtB protein will change to some extent, which may affect the function of the cdtB protein, and it is difficult for a single cdtB protein to enter the cell. At the same time, the microinjection conditions are relatively high and affect the cell state. A large dose of cdtB protein is used to mix with cells, but this method requires a large amount of cdtB protein, which greatly hinders the research progress on the effect of cdtB gene on cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Over-expressed lentiviral vector of cdtB gene and construction method thereof as well as lentivirus containing cdtB gene and application thereof
  • Over-expressed lentiviral vector of cdtB gene and construction method thereof as well as lentivirus containing cdtB gene and application thereof
  • Over-expressed lentiviral vector of cdtB gene and construction method thereof as well as lentivirus containing cdtB gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0074] The present invention provides a lentivirus containing cdtB gene, which is prepared by the following steps:

[0075] Ⅰ. Mix the pLVX-AcGFP1-N1-cdtB constructed by the above technical scheme with VSVG and pCMVΔR8.2 according to the mass ratio of 2:1:1 to obtain the plasmid mixture;

[0076] Ⅱ. Mix the plasmid mixture and liposome according to the volume ratio of 8:15, let it stand still, add the mixture after standing still to the cells cultured in serum-free DMEM, and after culturing for 7 hours, replace the medium to complete Culture medium;

[0077] III. The cells were cultured for 48 hours under the condition of complete medium, and the cell supernatant was collected and filtered to obtain the lentivirus containing the cdtB gene.

[0078] In the present invention, the pLVX-AcGFP1-N1-cdtB constructed by the above technical scheme is mixed with VSVG and pCMVΔR8.2 according to the mass ratio of 2:1:1 to obtain a plasmid mixture. The VSVG is an expression plasmid with ...

Embodiment 1

[0093] In the following examples, the experimental methods for which specific conditions are not indicated are generally in accordance with conventional conditions, such as "Refined Molecular Biology Experiment Guide" (F.M. The translation. Beijing: Science Press, 2004) method described in.

[0094] Design specific primers to amplify the cdtB fragment. The primer sequences are as follows:

[0095] CDTB-F CCG CTCGAG ATGAGAATACTATTATGCTT

[0096] wxya

[0097] CDTB-R CGC GGATCC CTCCTAAAAATCGTCCAAA

[0098] BamHI

[0099] The PCR reaction system is shown in Table 1:

[0100]

[0101] The PCR reaction program is shown in Table 2:

[0102]

[0103] 1% agarose gel electrophoresis detects the PCR product, and the band is in line with expectations at about 800bp ( figure 1 ). Among them, the band size is 837bp; 1 is a positive sample, 2 is a blank control, and 3 is a 200bp Marker.

Embodiment 2

[0105] The PCR product was recovered by gel, the cdtB fragment was connected to the T vector using a T vector ligation kit, transformed into E. coli competent cells, positive colonies were selected for expansion, and the T vector with the cdtB fragment was extracted using a plasmid extraction kit.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an over-expressed lentiviral vector of a cdtB gene and a construction method thereof as well as a lentivirus containing the cdtB gene and application thereof, and belongs to the technical field of gene engineering. According to the over-expressed lentiviral vector of the cdtB gene pLVX-AcGFP1-N1-cdtB, the cdtB gene is introduced at multiple cloning site based on pLVX-AcGFP1-N1 lentiviral expression vector. The invention also provides a lentivirus containing the cdtB gene. By mixing the pLVX-AcGFP1-N1-cdtB vector constructed and a lentivirus packaging system VSVG and pCMVdeltaR8.2, the packaging process of the lentivirus is achieved to obtain the lentivirus which directly infects the eukaryocyte, so that a purpose that the cdtB gene is normally expressed in the eukaryocyte, thereby laying a good foundation for understanding the cdtB gene.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a cdtB gene overexpression lentiviral vector and a construction method thereof, a lentivirus containing the cdtB gene and applications thereof. Background technique [0002] CDT is a cytotoxic protein produced by some Gram-negative bacteria, including Campylobacter jejuni, certain Escherichia coli, Shigella dysenteriae, Haemophilus, and Helicobacter hepatica. The complete CDT protein consists of three subunits, cdtA, cdtB, and cdtC, in which cdtA binds to the cell membrane, and cdtC helps cdtB enter the cell, and then cdtB causes cytotoxicity. CdtB is Mg 2+ , Ca 2+ Dependent neutral nuclease, containing DNA hydrolysis and cation-binding domains, triggers DNA damage in host cells by hydrolytically breaking phosphodiester bonds, and leads to elongation of cytoplasm and nucleus, activates cell cycle checkpoints to block cell cycle G2 / M period, eventually l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/66C12N15/12
Inventor 张泉谢灵志于宁孙靖谕钱淼
Owner YANGZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More