Application of rice FAH gene in rice fertility control
A technology of rice and genes, applied in the field of genetic engineering applications
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] Example 1 Cloning and sequence analysis of rice FAH gene cDNA
[0017] Rice Nipponbare seeds were germinated at 37°C for 1 day, then sown in the greenhouse, and the leaves of three-leaf stage rice were taken to extract RNA. RNA was extracted using RNAiso Plus reagent from Dalian TAKARA Company. The specific operation steps were as follows: ① Take 100 mg of rice leaves, grind them into powder with liquid nitrogen, add 1 ml of RNAiso Plus solution, mix well, place at room temperature for 5 min, and centrifuge at 12,000 rpm / min. 5min, take the supernatant; ②add 200ul chloroform to the supernatant, mix well, let stand at room temperature for 5min, centrifuge at 12000rpm / min for 10min, take the supernatant; ③add 500ul isopropanol, mix well, Let stand at room temperature for 10 minutes, centrifuge at 12000rpm / min for 15 minutes, and take the precipitate; ④ wash the precipitate twice with 500ul 75% ethanol; RNA was reverse-transcribed into cDNA using the ReverTraAce qPCR RT M...
Embodiment 2
[0019] Example 2 Expression Analysis of FAH Gene in Different Rice Tissues
[0020] Using the roots, stems, leaves and young panicles of rice Nipponbare at the booting stage as materials, the expression levels of FAH gene in different tissues of rice were analyzed.
[0021] The RNA extraction and reverse transcription method of the root, stem, leaf and young ear of rice Nipponbare at the booting stage are the same as in Example 1. Fluorescent quantitative PCR was used to analyze the expression level of FAH gene in different tissues. According to the cloned FAH gene sequence, fluorescent quantitative PCR primers OSFAH1 (5'-CGCCAGGAAACGCTCAAC-3', see SEQ ID No.5) and OSFAH2 (5'-GTCGCTCATGGGAACAAGG-3', see SEQ ID No.6) were designed. Using OSFAH1 and OSFAH2 as primers, RNA reverse transcription products of various rice tissues as templates, the reaction system was 20ul (template 400ng, OSFAH1 and OSFAH2 each 0.8ul, fluorescent quantitative reagent FastStart Universal SYBR Green ...
Embodiment 3
[0022] Example 3 Identification of FAH gene interference expression transgenic rice
[0023] In order to further identify the function of the FAH gene in the development of rice young panicles, the present invention constructed an interference expression vector of the FAH gene, transformed the rice Nipponbare, and observed the fertility of the FAH interference-expressed transgenic rice. Specific steps are as follows:
[0024]A. According to the sequence of the rice FAH gene that has been cloned (as shown in SEQ ID No.3), adopt Premier 5 software to design specific primer P1 (CAGCTTGTTGCAAGGGT, see SEQ ID No.9) and P2 (GACTTCAAATAAGTTCTTATTGTAAC, see SEQ ID No .10), using the cloned FAH gene as a template, use the high-fidelity enzyme TransStart FastPfu DNA Polymerase (TRNAsGen) to PCR amplify the FAH gene sequence, and the PCR reaction system is 25ul, including 5×TransStart FastPfu Buffer 5ul, 2.5mM dNTP 2.5ul , 10mM primer P1 1ul, 10mM primer P2 1ul, rice FAH gene cDNA 10ng,...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com