LAMP (loop-mediated isothermal amplification) primer group and method for detecting transgenic ingredient CaMv35S
A primer set, camv-f3 technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial assay/inspection, etc., can solve the problems of high detection cost, cumbersome detection operation, high investment, etc. Avoid false positives and reduce investment
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0021] Example 1 Design of LAMP primer set for detection of CaMV35S promoter
[0022] In this embodiment, the LAMP primer set for detecting the CaMV35S promoter includes the LAMP primer set including CaMV-F3 primers, CaMV-B3 primers, CaMV-FIP primers, CaMV-BIP primers, CaMV-LF primers, and CaMV-LB primers; Wherein, the CaMV-F3 primer has a sequence structure as shown in SEQ ID No.1; the CaMV-B3 primer has a sequence structure as shown in SEQ ID No.2; the CaMV-FIP primer has a sequence structure as shown in SEQ ID No.2; The sequence structure shown in No.3; the CaMV-BIP primer has the sequence structure shown in SEQ ID No.4; the CaMV-LF primer has the sequence structure shown in SEQ ID No.5; the CaMV - The LB primer has a sequence structure as shown in SEQ ID No.6.
[0023] Said SEQ ID No.1: 5`-GGCTCCTACAAATGCCATCA-3`
[0024] Said SEQ ID No.2: 5`-GATAGTGGGATTGTGCGTCA-3`
[0025] The SEQ ID No.3: 5`-GGTGGGGGTCCATCTTTGGGTTTTAGGAAAGGCCATCGTTGAA-3`
[0026] The SEQ ID No.4: 5`...
Embodiment 2
[0029] Example 2 Detection of the CaMV35S promoter of the LAMP primer set
[0030]The positive control solution of the transgenic component CaMV35S promoter used in this example was purchased from General Biosystems (Anhui) Co., Ltd., and the gene fragment of the CaMV35S promoter has a sequence structure as shown in SEQ ID No.7, and the SEQ ID No.7 is GCTCCTACAAATGCCATCATTGCGATAAAGGAAAGGCCATCGTTGAAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATC; the DNA extraction kit was purchased from Bioengineering (Shanghai) Co., Ltd. It should be noted that not only the positive control solution of the CaMV35S promoter and the DNA extraction kit are commercially available conventional materials disclosed in the prior art, but the Bst DNA polymerase and deoxyribonucleoside triphosphate used in this example , Bst DNA polymerase buffer, betaine, MgSO 4 , deionized water, 4-(2-pyridylazo)reso...
Embodiment 3
[0038] Example 3 Detection of CaMV35S promoter by LAMP primer set
[0039] The LAMP primer set described in Example 1 is used to detect the CaMV35S promoter, and the specific steps are as follows:
[0040] Take 1 µl of the CaMV-F3 primer at a concentration of 10 µM, 1 µl of the CaMV-B3 primer at a concentration of 10 µM, 1 µl of the CaMV-FIP primer at a concentration of 40 µM, 1 µl of the CaMV-BIP at a concentration of 40 µM, and 1 µl of the CaMV-BIP at a concentration of 40 µM. 20µM of the CaMV-LF primer, 1µl of 20µM CaMV-LB primer, 5µl of 5M betaine (English name betaine), 3µl of 150mM deoxyribonucleoside triphosphate (dNTP for short), 0.5 µl of 100mM MgSO 4 , 2.5µl concentration of 10× Bst DNA polymerase buffer (English name Bst DNA Polymerase Buffer), 1µl concentration of 8U / µl BstDNA polymerase (English name Bst DNA Polymerase), 5µl deionized water, and 2µl The positive control solution and the negative control solution described in Example 2 were mixed, the two groups ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com