Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Phalaenopsis flowering gene PhalLFY and application thereof

A phalaenopsis and gene technology, applied in the fields of molecular biology and genetic engineering, can solve the problems of early flowering and functional changes, and achieve the effect of great economic value and wide application prospects.

Pending Publication Date: 2017-01-11
SOUTH CHINA AGRI UNIV +1
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the tobacco NFL1 gene cannot advance the flowering time after being transferred into Arabidopsis (Ahearn et a1.,2001)
The above situation shows that although the protein sequence encoded by the LFY homologous gene is very conservative, its function has also changed due to some structural changes during the evolution process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phalaenopsis flowering gene PhalLFY and application thereof
  • Phalaenopsis flowering gene PhalLFY and application thereof
  • Phalaenopsis flowering gene PhalLFY and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] 1. Cloning and homology analysis of the PhalLFY gene of Phalaenopsis.

[0036] (1) Flower buds of Phalaenopsis hybrida cv. Wedding Promenade were used as experimental materials, and the materials were grown under normal conditions in the greenhouse (12h / 12h; 25-28°C).

[0037] (2) RNA extraction: Trizol reagent (purchased from Invitrogen) was used to extract the total RNA of the test materials. The whole operation process was strictly in accordance with the RNA extraction process description of the Trizol reagent, and then the total RNA was used as a template to reverse transcribe to obtain the first cDNA. chain.

[0038] (3) Cloning of the gene: using the first strand of reverse-transcribed Phalaenopsis flower bud cDNA as a template, PCR amplification was performed using primers LFY-F and LFY-R, the PCR product was recovered, sequenced, and a core fragment of 600 bp was obtained.

[0039] LFY-F:5'-CGGAYATIAAYAARCCIAARATGMGICAYTA-3'

[0040] LFY-R:5'-CGACGTGICKIARIYKI...

Embodiment 2

[0048] Analysis of Gene Expression Patterns of Flowering Gene PhalLFY in Phalaenopsis

[0049] In Phalaenopsis vegetative growth period and reproductive growth period, get the root, stem, leaf of vegetative growth period and the root, stem, leaf and pedicel organ of reproductive growth period, extract the total RNA of these organs respectively with Trizol reagent (Invitrogen), Quantitatively remove 2 μg RNA after measuring OD260, and then use oligo-dT primer and PrimeScript TM ReverseTranscriptase (purchased from Takara Company) carried out reverse transcription reaction (method reference manual), with specific primers LF: 5'-ATCCCCGCCTCTCAATCT-3' and LR: 5'-TCTCATCCGCACCAGTTC-3'. PCR amplification was carried out, and the reaction product was 1.0% Agarose gel electrophoresis separation, the electrophoresis results are as follows figure 2 and 3 Shown, PhalLFY gene is all expressed in each organ of Phalaenopsis, and in the vegetative growth stage, the expression of PhalLFY ...

Embodiment 3

[0051] Expression of Phalaenopsis PhalLFY gene in Arabidopsis and phenotypic identification of transgenic plants.

[0052] (1) Construction of expression vector containing target gene PhalLFY

[0053] Design primer PhLFYF 5'AATTCTAGAATGGACCCAAGCGACGCCTTCTCC3'

[0054] PhLFYR 5'CATGGATCCCTAAAGCATGGAAGGAGGGATTCC3'

[0055] Using the cDNA of the Phalaenopsis flower bud as a template, using PhLFYF and PhLFYR as primers to amplify the Phalaenopsis PhalLFY gene with restriction sites XbaI and BamH I, connected to the PMD18-T vector of Takara, and then according to J. Sambrook et al. "Molecular Cloning Experiment Guide" for transformation and identification. The identified positive plasmid utilizes restriction site Xba I and EcoR I to excise the PhalLFY gene from the T vector, and connects it with the plant expression vector pBI121 with 35s promoter and nos terminator after digestion with XbaI and EcoR I, An expression vector pBI121-35s-PhalLFY was constructed (verified by sequenc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phalaenopsis flowering gene PhalLFY and application thereof. The sequence of the phalaenopsis flowering gene PhalLFY is as shown in the specification from the 41 base to the 1462 base of SEQ ID NO.1, and the encoded protein amino acid sequence of the gene PhalLFY is as shown as SEQ ID NO.2. The homologous gene PhalLFY of the gene LFY is cloned from phalaenopsis for the first time, and capable of affecting plant growth and development, promoting precocious flowering of plants and promoting axillary buds and lateral buds to gown into flower buds as proved by tests. Therefore, based on the phalaenopsis flowering gene PhalLFY, an effective technical means is provided for improving plant growth process through genetic engineering and regulating the flowering time; the phalaenopsis flowering gene PhalLFY has wide application prospect and high economic value.

Description

[0001] Technical field: [0002] The invention belongs to the technical fields of molecular biology and genetic engineering, and in particular relates to a flower meristem-determining gene expressed in Phalaenopsis-PhalLFY gene, a recombinant plant expression vector containing the gene, and the role of PhalLFY gene in promoting the development of multiple flowering branches of plants and in promoting early flowering of plants [0003] Background technique: [0004] In plant ontogeny, floral differentiation is the beginning of reproductive growth. First, the vegetative meristem transforms into the inflorescence meristem, then the inflorescence meristem transforms into the floral meristem, next, the floral meristem gives rise to floral organ primordia, and finally various floral organs. The identified floral meristem-determining genes are LEAFY (LFY), APETALA1 (AP1), CAULIFL OWER (CAL), APETALA2 (AP2), and UNUSUAL FLORAL ORGANS (UFO) (Weigel et al., 1992; Yanofsky, 1995 ), amon...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/82C12N5/10A01H5/00
CPCC07K14/415C12N15/827
Inventor 张建霞段俊吴坤林曾宋君何春梅郑枫
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com