A detection primer and fluorescent quantitative PCR detection method for Acinetobacter lwwei

Abstract

The invention provides a fluorescent quantitative PCR detection primer and method for Acinetobacter ruckeri. The nucleotide sequences of the primers are respectively: TTATTTGATCAGGCGCAAAG and CGTTTCTTGCCATCCCATTTA; the detection method includes: 1) extracting the DNA of the sample to be tested; 2) using the DNA as a template, using the above primers, and using the fluorescent quantitative PCR method to amplify Acinetobacter ruckeri , and the fluorescence value Ct was collected during the annealing stage at 55°C 样品 value; 3) according to the model bacteria concentration is ×10 2 ,×10 3 ,×10 4 ,×10 5 ,×10 6 ,×10 7 When the corresponding Ct 标准 Value, establish the bacteria number lg of Acinetobacter ruckeri 标准 with Ct 标准 A standard curve of values, and according to Ct 样品 value, the number of Acinetobacter ruckeri in the sample was determined on the standard curve. The primer provided by the invention has strong specificity and high sensitivity, and its detection limit can reach ×10 2 cfu / mL, the detection method is fast, accurate, and time-consuming.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a real-time fluorescence quantitative PCR detection method for Acinetobacter ruckeri. Background technique [0002] Acinetobacter lwoffii widely exists in nature, mainly in water and soil, and can also be detected in milk, dairy products, poultry and frozen food. Acinetobacter ruckeri is an important opportunistic pathogen, often causing sepsis, pneumonia, endocarditis, etc. [1] , in addition, Acinetobacter ruckeri can produce heat-resistant protease and lipase to destroy food ingredients, heat sterilization can destroy Acinetobacter ruckeri, but the activity of these heat-resistant enzymes is basically not affected, even after ultra-high temperature sterilization They will continue to decompose protein and fat during food storage, which will lead to changes in the product and eventually have an adverse effect on food quality: (1) Decomposing milk protein by p...

AI Technical Summary

Problems solved by technology

Among them, the medium separation and identification method is very cumbersome in actual operation, and is easily contaminated by bacteria in the environment: compared with the traditional separation and identification detection method, the common PCR method is more sensitive and faster, but it is not effective for Acinetobacter ruckeri The requirements for the content of bacteria liquid and the number of miscellaneous bacteria are relatively strict, and there may be false positive and false negative results, which will cause deviations in the degree of contamination of the screened food.

Images