Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Tumor vascular endothelial cell marker 8 mutant, fusion protein and application thereof

A technology of endothelial cells and fusion proteins, applied in the field of molecular biology, can solve the problem of no progress in TEM8 structural research

Active Publication Date: 2016-11-09
INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The crystal structures of CMG2 monomer and CMG2-PA complex have been reported abroad, but there has been no progress in the structural study of TEM8

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor vascular endothelial cell marker 8 mutant, fusion protein and application thereof
  • Tumor vascular endothelial cell marker 8 mutant, fusion protein and application thereof
  • Tumor vascular endothelial cell marker 8 mutant, fusion protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Expression of TEM8 mutant MT4

[0036] 1. Construction of the expression plasmid of mutant MT4

[0037] Using L56A-PHAT2 as a template, amino acids 152, 154-159 were mutated by inverse PCR technology, and the reaction system was 50 μL, as shown in Table 1.

[0038] Table 1. PCR reaction system (1)

[0039]

[0040] The reaction conditions are:

[0041]

[0042] The PCR product was subjected to template digestion, phosphorylation and ligation overnight; DH5α competent cells were transformed, coated with Amp-containing LB plates, and cultured until clones grew.

[0043] Primer sequence:

[0044] MT4-R: GCCATCGAGTTTTTCCATCAGTCAAAGCAATGATG

[0045] MT4-F: CTGGTGCCGAGCTATTCAGAGAGGGAGGCTAATAG

[0046] 2. Protein expression and purification

[0047] The sequenced and confirmed MT4-PHAT2 plasmid was transformed into BL21 Escherichia coli competent, and after the clones were grown, single clones were picked and cultured overnight, and then expanded to 1L an...

Embodiment 2

[0067] Example 2 Expression and analysis of HAS-MT4 fusion protein

[0068] 1. Construction of fusion protein of HSA and MT4

[0069] Fusion with HSA is a commonly used method to prolong the half-life of proteins. In order to construct HSA-MT4 fusion protein more conveniently, we modified the existing yeast expression plasmid pMEX9K-HSA-CMG2, and inserted two unique restriction enzyme sites NgoMIV and SpeI between linker and CMG2, Use one of the restriction enzyme sites and the existing NotI on the plasmid to connect MT4 into the expression vector, as shown in the schematic diagram. Image 6 shown.

[0070] The PCR process includes two steps: the first step is to add NgoMIV / SpeI and NotI restriction sites at both ends of MT4. The reaction system was 50 μL, see Table 2 for details.

[0071] Table 2. PCR reaction system (2)

[0072]

[0073] The reaction conditions are:

[0074]

[0075] The second step of PCR is to add NgoMIV / SpeI restriction sites after the HSA-CMG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Affinity constantaaaaaaaaaa
Login to View More

Abstract

The invention discloses a protein mutant of a tumor vascular endothelial cell marker 8, a fusion protein of the protein mutant and human serum albumin and application thereof in preparation of drugs for treatment and / or prevention of anthrax infection. The protein mutant disclosed by the invention significantly increases the affinity with an anthrax PA antigen, has similar inhibitory activity to anthrax toxin with sCMG2, has 100% protection rate on rats attached by anthrax toxin LeTx. When the protein mutant is fused with human serum albumin, the half-life in vivo is extended by nearly 10 times, and the fusion protein can completely protect test animals attacked by anthrax toxin LeTx in 14 days.

Description

technical field [0001] The invention discloses a recombinant fusion protein, which belongs to the field of molecular biology. Background technique [0002] Anthrax is a serious zoonotic infectious disease caused by Bacillus anthracis infection. Anthrax toxin is one of the main virulence factors of Bacillus anthracis, and it contains three protein components: Protective Antigen (PA), Lethal Factor (LF) and Edema Factor (EF). Anthrax toxin through PA and receptors on target cells tumor vascular endothelial cell marker 8 (Tumor Endothelial Marker 8 / Anthrax Toxin Receptor 1, TEM8) or capillary morphogenesis protein 2 (Capillary MorphogenesisProtein 2 / Anthrax Toxin Receptor 2, CMG2) Binding mediates the entry of LF and EF into the cell, so blocking the binding of PA to the receptor is an important target for the research of anthrax toxin inhibitors. Both CMG2 and TEM8 are single-pass transmembrane proteins that bind to PA through the vWA domain of the extracellular domain. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/47C07K19/00C12N15/12C12N15/81C12N1/19A61K47/48A61K39/00A61P31/04C12R1/84
Inventor 陈薇徐俊杰李亮亮郭强张军董大勇殷瑛蔡晨光付玲
Owner INST OF BIOENG ACAD OF MILITARY MEDICAL SCI OF THE CHINESE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com