Supercharge Your Innovation With Domain-Expert AI Agents!

Humanized recombinant vector and cell for dioxin-type substance biological detection

A technology for recombining vectors and recombining cells, applied to cells modified by introducing foreign genetic material, biochemical equipment and methods, animal cells, etc. Reflecting issues such as the impact of dioxin-like substances

Inactive Publication Date: 2016-08-24
RES CENT FOR ECO ENVIRONMENTAL SCI THE CHINESE ACAD OF SCI
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Most of the existing biological detection systems are based on the enhancer of the mouse CYP1A1 gene. Although they have a good response to dioxin-like pollutants, they cannot truly reflect the impact of dioxin-like substances on the human body.
The reason is that the AhR signaling pathway has significant species differences. For example, some PCBs can compete with 2,3,7,8-tetrachlorodibenzodioxin (TCDD) for binding to mouse AhR, but not Competes for binding to human AhR, indicating differences in the way murine and human AhR bind to dioxin-like compounds; there is also evidence that the sequences of the ligand-binding domains of murine and human AhR differ

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Humanized recombinant vector and cell for dioxin-type substance biological detection
  • Humanized recombinant vector and cell for dioxin-type substance biological detection
  • Humanized recombinant vector and cell for dioxin-type substance biological detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] The construction of embodiment 1 carrier

[0058] (1) Construction of pCL-HFL vector

[0059] Human genomic DNA comes from Hep G2 cells and is extracted according to the standard method of the kit. And through the standard molecular cloning means to construct and obtain pCL-HFL ( figure 1 ).

[0060] The purpose of this experiment is to construct a dioxin reporter gene detection vector including the original sequence of the human CYP1A1 promoter (-3534~-2448), which contains 6 DRE sequences. Using human genomic DNA as a template, a PCR reaction was performed with the following primers.

[0061] The 5' primer is: CGGGGTACCGAGGCTGGCCCTTTAAGAGC (SEQ ID NO: 1)

[0062] 3' primer is: CCCAAGCTTACTGCCACCTTTATAGGCGG (SEQ ID NO: 2)

[0063] After the PCR fragment was obtained, it was digested with Kpn Ⅰ and Hind Ⅲ, and the vector pGL3-basic was subjected to the same double digestion, and finally the fragment was constructed into pGL3-basic. Finally, after identification by...

Embodiment 2

[0087] Example 2 Vector transient transfer of Hep G2 cells to obtain optimal exposure time

[0088] Hep G2 cells were treated with 1×10 5 The amount per well was inoculated into a 24-well plate, and the carrier was transiently transfected with liposomes (LTX). That is, 0.5 μg vector (pCL-HFL or pCL-HCR2 vector) plus 1 / 50 amount of pRL-SV40 (control reporter gene vector, expressing Renilla luciferase) were co-transfected into cells for 22-24 hours. The cells were cultured in α-MEM medium (1% DMSO content) with a final concentration of 10 nM of TCDD for 4 h, 12 h, 24 h, and 48 h, and treated with a medium (without TCDD) with a final concentration of 1% DMSO under the same conditions. cells as a negative control. After the predetermined time, discard the original medium, wash with 500ml PBS, add 200μl cell lysate, shake at 400r / min for 15 minutes. Then pipette 50 μl of cell lysate into a 96-well white opaque microtiter plate, and repeat 3 times for each sample. Prepare the su...

Embodiment 3

[0090] Example 3 Concentration-effect curve obtained by transiently transfecting Hep G2 cells with vector

[0091] Hep G2 cells were treated with 1×10 5 The amount per well was inoculated into a 24-well plate, and the carrier was transiently transfected with liposomes (LTX). That is, 0.5 μg vector (pCL-HFL, pCL-HCR2 or pGL6.1 vector) plus 1 / 50 amount of pRL-SV40 (control reporter gene vector, expressing Renilla luciferase) was co-transfected into cells for 22-24 hours. Aspirate the old medium to a final concentration of TCDD of 1.0 x 10 -13 ~1.0×10 -8 M TCDD's α-MEM medium (1% DMSO content) cultured the cells for 24 hours, and the cells treated with the medium (without TCDD) with a final concentration of 1% DMSO under the same conditions were used as negative controls. After 24 hours, discard the original medium, wash with 500ml PBS, add 200μl cell lysate, shake at 400r / min for 15 minutes. Then pipette 50 μl of cell lysate into a 96-well white opaque microtiter plate, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant vector and a recombinant cell, in particular to a humanized recombinant vector and recombinant cell for detecting aromatic hydrocarbon receptor ligands (such as dioxin-type substances). The invention also relates to a purpose of the recombinant vector and cell in the aspects of biological detection of aromatic hydrocarbon receptor ligands (such as dioxin-type substances). The DRE-sequence-containing human CYP1A1 gene promoters or partial segments of the promoters are cloned to a basic genetic vector with a luciferase recording gene, the obtained recombinant vector and cell have good response on the dioxin; the lowest detection limit can reach 0.3pM; the humanized recombinant vector and cell are particularly suitable for elevating the influence of the aromatic hydrocarbon receptor ligands (such as dioxin-type substances) on the human body health and performing relevant mechanism study.

Description

technical field [0001] The invention relates to a recombinant carrier and a recombinant cell, in particular to a humanized recombinant carrier for detecting ligands (such as dioxins) of aromatic hydrocarbon receptors (AhR, also called dioxin receptors) and a recombinant cell containing the recombinant vector. The present invention also relates to the use of the recombinant vector and cells for detecting ligands of aromatic hydrocarbon receptors (such as dioxins). Background technique [0002] Dioxins, including polychlorinated dibenzodioxins (PCDDs), polychlorinated dibenzofurans (PCDFs) and polychlorinated biphenyls (PCBs), are typical persistent organic pollutants. substances with extensive toxic effects on the human body. Due to its environmental persistence, long-distance migration, refractory degradation and bioaccumulation, it will pose a long-term threat to human health. Historically, incidents of human exposure to dioxins have been frequent. For example, in 1949,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/65C12N5/10C12Q1/68
CPCC12N5/0693C12N15/65C12N15/85C12N2800/107C12N2830/34C12Q1/6897
Inventor 赵斌尹雪娇李帅章谢群慧
Owner RES CENT FOR ECO ENVIRONMENTAL SCI THE CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More