Gene and protein of bacterial laccase laclK and application
A protein and laccase technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as limiting the scope of application of laccase, long-term stability and poor heat resistance of laccase
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Kurthiahuakuii LAM0618 purchased from the China Agricultural Microbiology Culture Collection Management Center was used. T ) as the original bacterium, expanded and cultivated and extracted its genomic DNA as an amplified template; this Kouterella huagui was discovered by the inventor of the present invention and has been disclosed in academic journal documents.
[0041] Using primers (CGC GGATCC ATGACAACAACAATTTATACG, SEQ ID NO: 5; and, CCG CTCGAGTTACTTTCGCACGATAAAGCT, SEQ ID NO: 6) carried out PCR amplification on the above amplification template, and used BamHI and XhoI endonucleases to digest the amplified product and cloned it into the expression vector pET28a to obtain the pET28a-laclK prokaryotic expression plasmid, which was verified by sequencing , the pET28a-laclK prokaryotic expression plasmid contains the exogenous gene expression sequence shown in SEQ ID NO: 3, and can correctly express the protein shown in SEQ ID NO: 1.
[0042] The above pET28a-laclK ...
Embodiment 2
[0047] This example characterizes the LaclK obtained in Example 1.
[0048] Prepare 1 mL of decolorization system, which includes 50 mM Na 2 HPO 4 -KH 2 PO 4 (pH7.0) buffer, different final concentrations of ethyl violet, LaclK, halide ions and organic reagents, and a certain concentration of NO 3 - , SO 4 2- and humic acid. Each system was reacted at 60° C. in the dark for 1 hour, and the absorption value was detected at the maximum absorption wavelength of 596 nm.
[0049] Decolorization rate (%)=[(A 0 -A t ) / A 0 ]×100
[0050] A 0 、A t are the absorbance values at 596nm after t hours of reaction in the control group and the experimental group, respectively. The control group did not add enzyme solution and was replaced by an equal amount of buffer solution, and the experiment was repeated three times for each group.
[0051] Using 10μM ethyl violet as substrate, measure the change of decolorization rate when the amount of enzyme is 25-300U / L. Using 20 μM e...
Embodiment 3
[0062] This example characterizes the LaclK obtained in Example 1.
[0063] Use ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)), 2,6-DMP (2,6-dimethoxyphenol, dissolved in absolute ethanol ) and L-dopamine as substrates, to detect the optimal pH value and K for different substrates m (mM), K cat (s -1 ) and K cat / K m (mM -1 the s -1 ), the results are shown in Table 2.
[0064] Table 2
[0065] substrate
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com