Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene and protein of bacterial laccase laclK and application

A protein and laccase technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as limiting the scope of application of laccase, long-term stability and poor heat resistance of laccase

Active Publication Date: 2016-06-15
INST OF AGRI RESOURCES & REGIONAL PLANNING CHINESE ACADEMY OF AGRI SCI
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the long-term stability and heat resistance of existing laccases are poor, thus limiting the scope of application of laccases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene and protein of bacterial laccase laclK and application
  • Gene and protein of bacterial laccase laclK and application
  • Gene and protein of bacterial laccase laclK and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Kurthiahuakuii LAM0618 purchased from the China Agricultural Microbiology Culture Collection Management Center was used. T ) as the original bacterium, expanded and cultivated and extracted its genomic DNA as an amplified template; this Kouterella huagui was discovered by the inventor of the present invention and has been disclosed in academic journal documents.

[0041] Using primers (CGC GGATCC ATGACAACAACAATTTATACG, SEQ ID NO: 5; and, CCG CTCGAGTTACTTTCGCACGATAAAGCT, SEQ ID NO: 6) carried out PCR amplification on the above amplification template, and used BamHI and XhoI endonucleases to digest the amplified product and cloned it into the expression vector pET28a to obtain the pET28a-laclK prokaryotic expression plasmid, which was verified by sequencing , the pET28a-laclK prokaryotic expression plasmid contains the exogenous gene expression sequence shown in SEQ ID NO: 3, and can correctly express the protein shown in SEQ ID NO: 1.

[0042] The above pET28a-laclK ...

Embodiment 2

[0047] This example characterizes the LaclK obtained in Example 1.

[0048] Prepare 1 mL of decolorization system, which includes 50 mM Na 2 HPO 4 -KH 2 PO 4 (pH7.0) buffer, different final concentrations of ethyl violet, LaclK, halide ions and organic reagents, and a certain concentration of NO 3 - , SO 4 2- and humic acid. Each system was reacted at 60° C. in the dark for 1 hour, and the absorption value was detected at the maximum absorption wavelength of 596 nm.

[0049] Decolorization rate (%)=[(A 0 -A t ) / A 0 ]×100

[0050] A 0 、A t are the absorbance values ​​at 596nm after t hours of reaction in the control group and the experimental group, respectively. The control group did not add enzyme solution and was replaced by an equal amount of buffer solution, and the experiment was repeated three times for each group.

[0051] Using 10μM ethyl violet as substrate, measure the change of decolorization rate when the amount of enzyme is 25-300U / L. Using 20 μM e...

Embodiment 3

[0062] This example characterizes the LaclK obtained in Example 1.

[0063] Use ABTS (2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)), 2,6-DMP (2,6-dimethoxyphenol, dissolved in absolute ethanol ) and L-dopamine as substrates, to detect the optimal pH value and K for different substrates m (mM), K cat (s -1 ) and K cat / K m (mM -1 the s -1 ), the results are shown in Table 2.

[0064] Table 2

[0065] substrate

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides protein of bacterial laccase laclK. An amino sequence of the protein is uniform with SEQ ID NO:1 by at least 90%, and the protein has laccase activity. The invention further provides gene of the bacterial laccase laclK. The gene codes the protein of the bacterial laccase laclK. The invention further provides a decoloring method. The decoloring method includes: enabling a to-be-decolored material to contact with the protein of the bacterial laccase laclK under enzymatic reaction. The invention further provides application of the protein of the bacterial laccase laclK in detection analysis of dye and treatment of printing and dyeing wastewater. The bacterial laccase laclK has high long-time stability and heat resistance and can be applied in a wider application range.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a bacterial laccase-like laclK protein, a gene encoding the protein, an application of the protein and a decolorization method. Background technique [0002] Dyes are widely used in textile dyeing, paper, cosmetics, food and other industries. In industry, there are nearly 10,000 kinds of dyes and pigments used in the world every year, more than 7×10 5 Ton. During the dyeing process, 10-15% of the dyes are discharged along with the wastewater. The composition of colored industrial wastewater is complex and highly toxic, which seriously endangers the health of aquatic organisms and human beings. Therefore, the removal or degradation of dyes in wastewater is of great significance to the ecological environment and biological health. [0003] At present, the methods for treating dye wastewater include physical, chemical and biological methods. Physical and chemical methods have many ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C02F3/34
CPCC02F3/342C12N9/0061C12Y110/03002
Inventor 阮志勇郭翔胡国全王彦伟赵秉强李燕婷王慧敏周义清
Owner INST OF AGRI RESOURCES & REGIONAL PLANNING CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com