Primers, probes and method for detecting Mycobacterium tuberculosis drug-resistant gene mutation sites
A technology of mycobacterium tuberculosis and mutation sites, applied in the field of medical monitoring, can solve the problems of cumbersome operation and heavy workload
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0103] The known sample 1 contains isoniazid and fonoquinone drug-resistant Mycobacterium tuberculosis, which is detected by the method of the present invention, and the specific steps are as follows:
[0104] a. Extract the total DNA in the sample;
[0105] b. Using the total sample DNA extracted in step a as a template, use the primers katG-F and katG-R of the katG gene, the primers inhA-F and inhA-R of the inhA gene, and the primers rpoB-F and rpoB-R of the rpoB gene , gyrA gene primers gyrA-F and gyrA-R for the first round of PCR. The sequences of each primer are as follows:
[0106] katG-F: CTGGTCCGTACTTCCGAGCGGTCGGCGGTCACACTTTCGGTA
[0107] katG-R: TACAGTCGGTCGCGTGCCTCAACGGGTCCGGGATGGTGCC
[0108] inhA-F: CTGGTCCGTACTTCCGAGCGAAGGGATCCGTCATGGTCGAAGT
[0109] inhA-R: TACAGTCGGTCGCGTGCCTCGTTGGACACCAGCACCTCGAC
[0110] rpoB-F: CTGGTCCGTACTTCCGAGCGGGCGAGCTGATCCAAAACCAGA
[0111] rpoB-R: TACAGTCGGTCGCGTGCCTCCGACAGCGAGCCGATCAGAC
[0112] gyrA-F: CTGGTCCGTACTTCCGAGCGAGGAG...
Embodiment 2
[0152] It is known that the known sample 2 contains rifampicin and fenoquinone drug-resistant Mycobacterium tuberculosis, which is detected by the method of the present invention. The specific steps are the same as in Example 1, and the results of the fluorescence detection values are as shown in Table 1. The fluorescence value of the wild-type probe katG-315AGC at the 315th amino acid mutation site of the isoniazid resistance-related katG gene in this sample is 1646, which is greater than 100, and is twice the fluorescence value of the mutant probe katG-315ACC, so the The sample does not contain drug-resistant mutations related to amino acid 315 of the katG gene. The fluorescence value of the wild-type probe inhA--15C at the -15 amino acid mutation site of the isoniazid resistance-related gene inhA gene in this sample is 395.5, which is greater than 100, and is two times the fluorescence value of the mutant probe inhA--15T. times, so the sample does not contain inhA--15 ami...
Embodiment 3
[0157]It is known that the known sample 3 contains rifampicin and fenoquinone drug-resistant Mycobacterium tuberculosis, which is detected by the method of the present invention. The specific steps are the same as in Example 1, and the results of the fluorescence detection values are as shown in Table 1. The fluorescence value of the wild-type probe katG-315AGC at the 315th amino acid mutation site of the isoniazid resistance-related katG gene in this sample is 2043.5, greater than 100, and twice the fluorescence value of the mutant probe katG-315ACC, so the The sample does not contain drug-resistant mutations related to amino acid 315 of the katG gene. The fluorescence value of the wild-type probe inhA--15C at the -15 amino acid mutation site of the isoniazid resistance-related gene inhA gene in this sample is 380.5, which is greater than 100, and is two times the fluorescence value of the mutant probe inhA--15T. times, so the sample does not contain inhA--15 amino acid-rel...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com