Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of bacterial solution and method for improving litchi coke rate

A technology of bacterial liquid and lychee, which is applied in the agricultural field, can solve the problems of small ripe fruit, no commercial value, and unusability, and achieve the effect of simple method, low cost, and increased coke core rate

Active Publication Date: 2018-11-27
SOUTH CHINA AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some studies have found that the use of cyanin can effectively increase the coke rate of litchi. However, the treatment of cyanin often leads to severe young fruit shedding or small mature fruit, which has no commercial value and other adverse effects, so it cannot be used in production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of bacterial solution and method for improving litchi coke rate
  • A kind of bacterial solution and method for improving litchi coke rate
  • A kind of bacterial solution and method for improving litchi coke rate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1 acid invertase gene screening and cloning

[0026] 1. RNA extraction and quality detection of litchi samples

[0027] Huayueyang ultra-fast RNA extraction kit (refer to the manual for the specific method) was used to analyze the leaves, flowers, pericarp, fruit pedicle, seed coat, seed kernel and other tissues of "feizixiao", "black leaf" and "nuomici" litchi The RNA was extracted, and the concentration of RNA was measured with an ultraviolet nucleic acid protein detector. Take 1 μl to measure the ratio of 260nm to 280nm. If it is between 1.80 and 2.00, the next step of the experiment can be carried out. If the RNA concentration is high, it can be diluted to a certain number of times before detection.

[0028] The results of agarose gel electrophoresis figure 1 , it can be seen that RNA presents two clear bands of 28S and 18S, and the brightness of 28S is about twice that of 18S, there is no tailing phenomenon, and no DNA pollution. It shows that the qua...

Embodiment 2

[0049] The preparation of embodiment 2 infection liquid

[0050] 1. Cloning of the LcCWAI gene fragment

[0051] Design primers with a fragment of about 500bp (sequence such as SEQ ID NO: 1) with relatively high homology of litchi LcCWAIs, and add a 15bp carrier sequence adapter homologous to the BamHI and SmaI restriction sites of pTRV2 before the primers, and the primers The sequence is shown in Table 4. The PCR amplification conditions are 94°C, 2min; 98°C, 10s, 55°C, 30s, 72°C, 30s, 30 cycles; 72°C, 10min; after amplification, take 2μl for agarose gel electrophoresis detection and purification.

[0052] Table 4 Fragment cloning primers constructed by VIGS vector

[0053] Primer name

Primer sequence (5'-3')

CWAI-TRV2-F

GCCTCCATGGGGATCCGATAAGGTGTGGAGAGTGTTGGTTG

CWAI-TRV2-R

CTTCGGGACATGCCCGGGAAACCCTCCTCTGCTTCTCACTATC

[0054] 2. Digestion of virus silencing vector pTRV2 (pYL156)

[0055] The structure diagram of virus silencing vect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of agriculture, and particularly discloses a bacterium solution and method for increasing the litchi seed abortion rate. The bacterium solution contains agrobacterium engineering bacteria obtained by converting LcCWAIs gene segments of a silencing expression carrier, litchi plants are dipped in the bacterium solution, seed development of a large-seed litchi variety is effectively restrained, and the seed abortion rate of large-seed litchis is increased. The method is simple and low in cost, it is verified through experiments that the control effect on seeds is successful, the silencing effect is maintained only for half a month, the bacterium solution only takes effect in the initial stage of seed development and automatically loses effect later without residues, fruit growth in the later stage is not affected, and the bacterium solution and method have wide application prospects in production.

Description

technical field [0001] The invention relates to the technical field of agriculture, more specifically, to a bacterial liquid and a method for increasing the coke rate of litchi. Background technique [0002] Litchi is a characteristic fruit in the south of our country. Seed size is one of the important traits that affect the quality of litchi fruit. The edible rate of litchi with burnt core is high and the taste is also good. The coke rate is a very important index to evaluate the quality of litchi. The currently cultivated high-quality litchi varieties, such as Nuomici and Guiwei in Guangdong; Lanzhu and Lvhebao in Fujian, Lingshan Xiangli in Guangxi, etc., are all characterized by coke core. [0003] The market price of large-core lychee varieties is low, and some abortive varieties such as Guiwei have large price differences due to different coke core rates. Seed size directly affects the price of lychees and the economic benefits of lychees. Some studies have found tha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/84A01H5/08A01H6/00C12R1/01
Inventor 王惠聪张洁琼吴子辰刘恋赵杰堂黄旭明
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com