Bacterium solution and method for increasing litchi seed abortion rate
A technology of bacterial liquid and litchi, which is applied in the agricultural field, can solve the problems of small ripe fruit, no commercial value, and unusability, and achieve the effect of simple method, low cost, and increased coke core rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment 1 acid invertase gene screening and cloning
[0026] 1. RNA extraction and quality detection of litchi samples
[0027] Huayueyang ultra-fast RNA extraction kit (refer to the manual for the specific method) was used to analyze the leaves, flowers, pericarp, fruit pedicle, seed coat, seed kernel and other tissues of "feizixiao", "black leaf" and "nuomici" litchi The RNA was extracted, and the concentration of RNA was measured with an ultraviolet nucleic acid protein detector. Take 1 μl to measure the ratio of 260nm to 280nm. If it is between 1.80 and 2.00, the next step of the experiment can be carried out. If the RNA concentration is high, it can be diluted to a certain number of times before detection.
[0028] The results of agarose gel electrophoresis figure 1 , it can be seen that RNA presents two clear bands of 28S and 18S, and the brightness of 28S is about twice that of 18S, there is no tailing phenomenon, and no DNA pollution. It shows that the qua...
Embodiment 2
[0049] The preparation of embodiment 2 infection liquid
[0050] 1. Cloning of the LcCWAI gene fragment
[0051] Design primers with a fragment of about 500 bp (sequence such as SEQ ID NO: 1) with relatively high homology of litchi LcCWAIs, and add a 15 bp carrier sequence adapter homologous to the BamHI and SmaI restriction sites of pTRV2 before the primers. See the primer sequence Table 4, PCR amplification conditions are 94°C, 2min; 98°C, 10s, 55°C, 30s, 72°C, 30s, 30 cycles; 72°C, 10min; after amplification, take 2μl for agarose gel electrophoresis detection, and purified recovery.
[0052] Table 4 fragment cloning primers constructed by VIGS vector
[0053] Primer name
Primer sequence (5'-3')
CWAI-TRV2-F
GCCTCCATGGGGATCCGATAAGGTGTGGAGAGTGTTGGTTG
CWAI-TRV2-R
CTTCGGGACATGCCCGGGAAACCCTCCTCTGCTTCTCACTATC
[0054] 2. Digestion of virus silencing vector pTRV2 (pYL156)
[0055] The structure diagram of virus silencing vector pTRV1 (p...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com