Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Soybean GmSAMS1 gene and application thereof

A technology of soybeans and genes, applied in the field of soybean GmSAMS1 gene and its application, can solve the problems of safety disputes of transgenic plants and their products, and achieve the effect of improving plant insect resistance and insect resistance

Inactive Publication Date: 2015-12-23
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, most of the genes used in insect resistance research are exogenous genes, such as Bt genes, but the safety of transgenic plants and their products is still controversial, so it is of great significance to study and utilize soybean endogenous resistance genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean GmSAMS1 gene and application thereof
  • Soybean GmSAMS1 gene and application thereof
  • Soybean GmSAMS1 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Cloning and Identification of Example 1 Soybean GmSAMS1 Gene

[0030] The experimental material is the cultivated soybean variety "Nannong 99-10", provided by the Germplasm Resources Research Office of the National Soybean Improvement Center of Nanjing Agricultural University. The material is planted in a net room and managed in the field.

[0031] Referring to the sequence information of the mustard SAMS enzyme gene (the accession number in the GeneBank database is AAG17666) and the soybean genome database (http: / / www.phytozome.net / soybean), use bioinformatics methods to analyze, design primers, and conduct soybean Cloning of the SAMS enzyme gene GmSAMS1. The specific method is as follows:

[0032] GmSAMS1 gene ORF forward primer P1: GGGGACAAGTTTGTACAAAAAAGCAGGCT CTACAGAAGTTAAAATGGCCCAAGAAACT (the attB link is underlined) (SEQ ID NO.3)

[0033] GmSAMS1 gene ORF reverse primer P2: GGGGACCACTTTGTACAAGAAAGCTGGGT GAGCAGGTACCTTCTCCCCCTT (the attB linker is underlined)...

Embodiment 2

[0035] Example 2 Study on Subcellular Localization of Soybean GmSAMS1 Gene

[0036] According to the cDNA full-length sequence of the GmSAMS1 that embodiment 1 obtains, utilize Invitrogen company's TechnologywithClonase TM II kit, insert the cloned GmSAMS1 (no stop codon) into the expression vector pMDC83 ( figure 1 ), the ORF of GmSAMS1 was fused with the 5' end of the GFP reporter gene in the pMDC83 vector to form a chimeric gene of GmSAMS1-GFP, and the recombinant plasmid pMDC83GmSAMS1-GFP was constructed. After PCR product sequencing verification, it and the empty vector pMDC83 were transformed into Agrobacterium by freeze-thaw method, and then onion epidermal cells were transformed by Agrobacterium-mediated method. It was found that the GmSAMS1 gene product was located on the cell membrane, while the pMDC83-GFP protein was distributed on the throughout the cell, indicating that soybean GmSAMS1 is localized on the cell membrane ( figure 2 ).

Embodiment 3

[0037] The acquisition of embodiment 3 transgenic GmSAMS1 gene tobacco

[0038] Using Invitrogen's TechnologywithClonase TM II kit, the GmSAMS1 cloned in Example 1 is forward inserted into the expression vector pMDC83 ( figure 1 ), transform Escherichia coli DH5α, and spread the transformation solution on LB solid medium containing 50 mg / L hygromycin + 50 mg / L kanamycin to screen for positive clones. After sequencing verification, the plasmid was extracted, and the pMDC83-GmSAMS1 plant overexpression vector obtained according to Example 2 ( image 3 ). Transform pMDC83-GmSAMS1 into Agrobacterium tumefaciens strain EHA105 (BiovectorCo., LTD) by freeze-thaw method, transform tobacco through Agrobacterium EHA105, extract the genomic DNA of transgenic tobacco as a template, and use non-transgenic tobacco as a template for tissue culture. As a control, the pMDC83-GmSAMS1 plasmid was used as a positive control, and the primers for the target gene were used to carry out PCR prel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering, and relates to a soybean GmSAMS1 gene and an application thereof. According to the soybean GmSAMS1 gene and the application thereof, one soybean S-adenosylmethionine synthetase gene GmSAMS1 is cloned from a soybean, and the sequence is SEQ ID NO.1. The protein level of the gene in a soybean leaf is changed after being induced by prodenia litura. Through a plant expression vector, the GmSAMS1 gene is introduced in a tobacco cell, the tobacco with overexpression GmSAMS1 is compared with a comparison tobacco, and the insect resistance to the prodenia litura is improved obviously. The invention discloses a genetic engineering improvement method for conducting plant insect resistance transformation through the gene. By the adoption of the method, a certain function is achieved on cultivation of a plant variety with the insect resistance changed, in particular a soybean variety, and the soybean GmSAMS1 gene and the application thereof can be used for increasing the yield and improving the quality of crops especially the soybean by directly transforming the insect resistance of the crops.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering and relates to soybean GmSAMS1 gene and its application. Background technique [0002] Soybean is an important economic crop, but insect pests seriously endanger the yield and quality of soybean. The use of chemical pesticides produces a series of side effects, including polluting the environment, destroying ecological balance, and increasing production costs. Breeding insect-resistant varieties through transgenic technology is an economical, effective and fast method. At present, most of the genes used in insect resistance research are exogenous genes, such as Bt genes, but the safety of transgenic plants and their products is still controversial, so it is of great significance to study and utilize soybean endogenous resistance genes. [0003] Plant induced resistance is one of the characteristics of plant resistance, which refers to the resistance produced by plants after being stimula...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C12N15/11C12N15/74C12N1/21C12N15/84A01H5/00
Inventor 王慧范蕊王永丽喻德跃
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com