Expression vector of Cap protein of porcine circovirus (PCV) 2 as well as construction method and application thereof
A porcine circovirus and expression vector technology, applied in the directions of viral peptides, antiviral agents, viral antigen components, etc., can solve the problems of high antigen content, high price, low virus proliferation titer, etc., to simplify the production process and reduce production. cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] The expression vector of porcine circovirus type 2 Cap protein is constructed by the following method:
[0066] 1) Obtain porcine circovirus type 2 ORF2 sequence: obtain PCV2 ORF2 sequence from the GeneBank sequence library;
[0067] 2) Codon optimization of the ORF2 sequence: according to the codon usage frequency in Escherichia coli, optimize the codons of the ORF2 sequence so that ORF2 can be expressed efficiently in Escherichia coli, and the nucleotide sequence of the optimized codon is SEQ ID NO .1 shown;
[0068] 3) PCR amplification: use the above-mentioned optimized codon as a template to perform whole-gene amplification using the stacked PCR method, and the primers used in the amplification process are SEQ ID NO.2-SEQ ID NO.3:
[0069] The sequence of the upstream primer from the 5' end to the 3' end is: CATGCCATGGGCACCTACCCGCGCCGTCGTT (SEQ ID NO.2);
[0070] The sequence from the 5' end to the 3' end of the downstream primer is: GTGCTCGAGTTACGGGTTCAGCGGCGGAT...
Embodiment 2
[0075] Utilize the pShac3 vector to express porcine circovirus type 2 Cap protein, the specific steps are as follows:
[0076] 1) Transform pShac3 into Escherichia coli BL21(DE3), screen with kanamycin LB plates, pick positive colonies and inoculate 5 mL of LB culture medium containing kanamycin, culture overnight at 37°C and 230rpm with shaking, and then expand the culture by 200 times After shaking culture at 37°C and 230rpm for 4h, OD6000.7, lower the temperature to 25-30°C, add IPTG with a final concentration of 0.1mM to induce culture for 10-12h; collect the bacteria by centrifugation, add 10mL per gram of the wet weight of the bacteria Resuspend the bacteria in the lysate, crush the bacteria 2 to 6 times with a high-pressure homogenizer at a pressure of 700 bar, and collect the supernatant by centrifugation;
[0077] 2) Purification of porcine circovirus type 2 Cap protein:
[0078] 1) Centrifuge 1L of the supernatant of the bacterial cells crushed by a high-pressure ho...
Embodiment 3
[0085] A porcine circovirus type 2 Cap protein vaccine, comprising an antigen and an adjuvant, said antigen is the porcine circovirus type 2 Cap protein obtained in claim 8, the volume ratio of the porcine circovirus type 2 Cap protein antigen and the adjuvant It is 4: 1, and the concentration of porcine circovirus type 2 Cap protein antigen is 37.5 μ g / mL; The preparation method of this porcine circovirus type 2 Cap protein vaccine is: the porcine circovirus 2 after purifying The type Cap protein was diluted to a concentration of 37.5 μg / mL, the water adjuvant GelST-01 was added in proportion, stirred at 800 rpm for 10 min, and the vaccine was prepared.
[0086] Effect verification
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com