Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression vector of Cap protein of porcine circovirus (PCV) 2 as well as construction method and application thereof

A porcine circovirus and expression vector technology, applied in the directions of viral peptides, antiviral agents, viral antigen components, etc., can solve the problems of high antigen content, high price, low virus proliferation titer, etc., to simplify the production process and reduce production. cost effect

Inactive Publication Date: 2015-11-25
GUANGDONG WENS DAHUANONG BIOTECH +2
View PDF6 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the domestic vaccine is an inactivated whole virus vaccine, the virus proliferation titer is low, and the production cost is high, resulting in not only high price, but also unsatisfactory immune effect
Boehringer Ingelheim uses rods to express the main immunogenic Cap protein, which not only has high antigen content and small side effects, but is expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector of Cap protein of porcine circovirus (PCV) 2 as well as construction method and application thereof
  • Expression vector of Cap protein of porcine circovirus (PCV) 2 as well as construction method and application thereof
  • Expression vector of Cap protein of porcine circovirus (PCV) 2 as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] The expression vector of porcine circovirus type 2 Cap protein is constructed by the following method:

[0066] 1) Obtain porcine circovirus type 2 ORF2 sequence: obtain PCV2 ORF2 sequence from the GeneBank sequence library;

[0067] 2) Codon optimization of the ORF2 sequence: according to the codon usage frequency in Escherichia coli, optimize the codons of the ORF2 sequence so that ORF2 can be expressed efficiently in Escherichia coli, and the nucleotide sequence of the optimized codon is SEQ ID NO .1 shown;

[0068] 3) PCR amplification: use the above-mentioned optimized codon as a template to perform whole-gene amplification using the stacked PCR method, and the primers used in the amplification process are SEQ ID NO.2-SEQ ID NO.3:

[0069] The sequence of the upstream primer from the 5' end to the 3' end is: CATGCCATGGGCACCTACCCGCGCCGTCGTT (SEQ ID NO.2);

[0070] The sequence from the 5' end to the 3' end of the downstream primer is: GTGCTCGAGTTACGGGTTCAGCGGCGGAT...

Embodiment 2

[0075] Utilize the pShac3 vector to express porcine circovirus type 2 Cap protein, the specific steps are as follows:

[0076] 1) Transform pShac3 into Escherichia coli BL21(DE3), screen with kanamycin LB plates, pick positive colonies and inoculate 5 mL of LB culture medium containing kanamycin, culture overnight at 37°C and 230rpm with shaking, and then expand the culture by 200 times After shaking culture at 37°C and 230rpm for 4h, OD6000.7, lower the temperature to 25-30°C, add IPTG with a final concentration of 0.1mM to induce culture for 10-12h; collect the bacteria by centrifugation, add 10mL per gram of the wet weight of the bacteria Resuspend the bacteria in the lysate, crush the bacteria 2 to 6 times with a high-pressure homogenizer at a pressure of 700 bar, and collect the supernatant by centrifugation;

[0077] 2) Purification of porcine circovirus type 2 Cap protein:

[0078] 1) Centrifuge 1L of the supernatant of the bacterial cells crushed by a high-pressure ho...

Embodiment 3

[0085] A porcine circovirus type 2 Cap protein vaccine, comprising an antigen and an adjuvant, said antigen is the porcine circovirus type 2 Cap protein obtained in claim 8, the volume ratio of the porcine circovirus type 2 Cap protein antigen and the adjuvant It is 4: 1, and the concentration of porcine circovirus type 2 Cap protein antigen is 37.5 μ g / mL; The preparation method of this porcine circovirus type 2 Cap protein vaccine is: the porcine circovirus 2 after purifying The type Cap protein was diluted to a concentration of 37.5 μg / mL, the water adjuvant GelST-01 was added in proportion, stirred at 800 rpm for 10 min, and the vaccine was prepared.

[0086] Effect verification

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression vector of a Cap protein of a porcine circovirus (PCV) 2 as well as a construction method and application thereof. The expression vector is obtained by cloning an optimized codon obtained after optimization of a gene ORF2 of the PCV 2 in a pET-28a vector. The expression vector and the construction method have the beneficial effects that the prokaryotic expression vector capable of efficiently expressing the main immunogenic Cap protein of the PCV 2 can be constructed and the Cap protein of the PCV 2 is efficiently expressed by utilizing escherichia coli, thus obviously reducing the antigen production cost, simplifying the production process and providing the cheap and fine vaccine product for the pig industry.

Description

technical field [0001] The invention belongs to the technical field of animal virus genetic engineering. In particular, it relates to a porcine circovirus type 2 Cap protein expression vector and a construction method and application thereof. Background technique [0002] Porcine circovirus type 2 (Porcine circovirus, PCV-2) is considered to be porcine postweaning multisystemic wasting syndrome (PMWS), proliferative necrotizing pneumonia (PNP), porcine skin and nephrotic syndrome (PDNS), porcine respiratory system The main pathogens of disease syndrome (PRDC), reproductive disorders, congenital tremor and enteritis are collectively referred to as porcine circovirus type 2 related diseases, and PCV-2 infection causes immunosuppression, which can easily lead to mixed infection or secondary infection of other pathogens Infection is one of the pathogens that seriously endanger the pig industry. In my country, almost 100% of pig farms are positive for porcine circovirus type 2 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N15/66C07K14/01A61K39/12A61P31/20
Inventor 陈瑞爱黄红亮张开岳任常宝唐满华佘峥单玉飞谢小雨邓小雄
Owner GUANGDONG WENS DAHUANONG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com