Anti-human Oct 4 (octamer-binding protein 4) monoclonal antibody as well as preparation and application of anti-human Oct 4 monoclonal antibody
A monoclonal antibody and recombinant protein technology, applied in the field of medical bioengineering, can solve problems such as unclear progression of liver cancer
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1. Preparation of recombinant protein of monoclonal antibody against human Oct4
[0035] 1. Construction of prokaryotic expression vector
[0036] Oct4A has 360 amino acids. According to its cDNA sequence information, Baiqi Biotechnology (Shanghai) Co., Ltd. was entrusted to design PCR primers SEQ ID NO: 3 and SEQ ID NO: 4:
[0037]Upstream primer: CCGGAATTCATGGCGGGACACCTGGCTTCGGATT (shown in SEQ ID NO: 3)
[0038] Downstream primer: ATAAGAATGCGGCCGCGTTTGAATGCATGGGAG (shown in SEQ ID NO: 4)
[0039] The cDNA of Oct4 obtained by PCR is shown as SEQ ID NO: 2, and cloned into the expression vector pET21a(+) by molecular cloning. For the method, please refer to J. Sambrook et al., translated by Jin Dongyan et al. "Molecular Cloning Experiment Guide (Second Edition) "reference book.
[0040] 2. Expression and purification of recombinant protein
[0041] The plasmid with 100% matching sequence was transformed into BL21(DE3), and a single colony was taken to ino...
Embodiment 2
[0042] Example 2. Preparation and purification of monoclonal antibody against human Oct4
[0043] 1. Antigen Purification
[0044] The antigen adopts prokaryotic recombinant protein, which is obtained by Baiqi Biotechnology (Shanghai) Co., Ltd. through molecular cloning, prokaryotic induced expression, and purification.
[0045] 2. Preparation and purification of monoclonal antibodies
[0046] Dilute 100 μg of the recombinant protein purified in the above 1 with PBS, mix and emulsify with an equal volume of complete Freund's adjuvant (CFA), and immunize 5 female BALB / c mice aged 5-6 weeks under the skin around the shoulders Subcutaneously and intramuscularly in both hind legs, approximately 1 / 8 of the immunogen was administered to each area, and 1 / 2 of the remaining immunogen was injected intraperitoneally. Two weeks later, booster immunization with 50 μg complete Freund's adjuvant, intraperitoneal injection. Four weeks later, 50 μg of incomplete Freund's adjuvant (IFA) was...
Embodiment 3
[0051] Example 3. Identification and detection application of monoclonal antibody against human Oct4
[0052] 1. Identification of monoclonal antibodies
[0053] (1) Antibody titer identification
[0054] The antigen (4μg / ml) was coated on the ELISA plate, and the purified anti-human Oct4 monoclonal antibody was carried out at 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000 Dilute and add to the wells of the microtiter plate, select commercialized Oct4 antibody (1mg / ml1:8000 diluted with milk) as the positive control of the system operation, and 5% milk as the negative control. After the reaction, goat anti-mouse IgG-HRP was added to develop the color. Positive judgment standard: the ratio (P / N) of the OD450 of the test well of the sample to the OD450 of the negative control well is ≥ 2.1, and the result shows that the antibody titer is greater than 64000 (Table 1).
[0055] Table 1 Antibody titer identification table
[0056] Dilution
1 / 1000
1 / 2...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com