Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Botryosphaeria dothidea detection method

A technology of Vitis vinifera and probe, applied in the field of inspection and quarantine, can solve the problems of affecting the detection accuracy of multiplex fluorescent PCR, excessive melting temperature difference, and increasing difficulty of multiplex PCR, etc.

Inactive Publication Date: 2015-07-15
PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF6 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In summary, with the increase of primer pairs, the melting temperature difference of each primer pair is too large, and the selection of inappropriate fluorescent probes and quenching groups will increase the difficulty of multiplex PCR, thus affecting the detection of multiplex fluorescent PCR. Accuracy,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Botryosphaeria dothidea detection method
  • Botryosphaeria dothidea detection method
  • Botryosphaeria dothidea detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Embodiment 1: the establishment of real-time fluorescent PCR system

[0080] 1. Detection of three fungal primers and probe design

[0081]According to the gene sequence of Botrytis EF1a published by GenBank, multiple alignments were performed to find out the conserved gene sequence. According to the design principles of primers and probes, the specificity of the three fungi was designed using Primer Express3.0 (Applied Biosystems) and Primer premier 5.0 Primer probe, and then verify the specificity of primer and probe by BLAST tool (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi), the sequence is as follows:

[0082] B. stevensii primer Bst-F: TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)

[0083] B. stevensii Primer Bst-R: CAAGTGCGGCCAGTTTGC (SEQ ID No.2)

[0084] B. stevensii probe Bst-T: TGCGCTTATCTGCCGCCGTG (SEQ ID No.3)

[0085] B. obtusa primer Bob-F: TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)

[0086] B. obtusa primer Bob-R: CAAGTGCGGCCAGTTTGC (SEQ ID No.2)

[0087] B. obt...

Embodiment 2

[0098] Embodiment 2: real-time PCR detection method specificity test

[0099] 1. Source of materials

[0100] Collect apple and pear ulcer branches and fruit with rotten symptoms, and use the conventional tissue PDA separation method to isolate and purify the strains. Some strains were purchased from ATCC and China Forestry Microbiology Collection Center CFCC, B. stevensii ATCC60259, B. stevensii ATCC64483, B. stevensii CFCC84208 , B. obtusa CFCC86564, B. dothidea bjsd-1, B. rhodina CFCC88424, B. rhodina CFCC88423, B. parva CFCC-88098, Lasiodiplodia crassispora CFCC87129. B. iberica bjbi-1. Magnetic nanoparticles were purchased from Promega.

[0101] 2. Fungal DNA Extraction

[0102] The tested strains were cultured on PDA medium at 28°C for 5-7 days, the bacteria cake was shaken in PDB for 5-7 days, and the mycelium was dried under sterile conditions for later use. Take about 100mg of mycelium and put it in a 1.5ml centrifuge tube, and use the magnetic bead method for nucl...

Embodiment 3

[0105] Embodiment 3: the sensitivity test of multiple real-time PCR detection method

[0106] 1. Method

[0107] Extract the genomic DNA of the tested strains B.stevensiiATCC60259, B.obtusa CFCC-86564, and B.dothidea bjsd-1 respectively, and use a UV spectrophotometer (NanoDrop Nano-1000, Thermo scientific) to measure the DNA concentration, and then perform a 10-fold serial concentration gradient Dilute, dilute to 10ng / μL, 1ng / μL, 10 -1 ng / μL, 10 -2 ng / μL, 10 -3 ng / μL, 10 -4 ng / μL, 10 -5 ng / μL, 10 -6 ng / μL eight concentration gradients, the three kinds of fungal DNA were mixed in equal proportions for real-time fluorescence detection, each concentration was repeated three times, and no DNA template was used as a negative control, and a standard curve was established according to the Ct value.

[0108] 2. Results

[0109] B.dothidea, B.obtusa, and B.stevensii three kinds of fungal DNA were mixed in equal proportions and diluted 10 times, and then multiple real-time fluor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a botryosphaeria dothidea detection method, and in particular relates to a triplex real-time fluorescent polymerase chain reaction (PCR) detection method for botryosphaeria dothidea, belonging to the technical field of inspection and quarantine. According to the method disclosed by the invention, three groups of botryosphaeria dothidea specific primers and probes are designed and a reaction system is optimized, so that a triplex real-time fluorescent quantitative PCR detection method is established, and the detection method can be used for simultaneously detecting and identifying multiple pathogenic fungi and determining a composite invading pathogen. By applying nano magnetic microparticles to the extraction of fungal nucleic acid, the fungal nucleic acid extraction is simpler and more efficient in operation; and meanwhile, in combination with a real-time fluorescent detection technology, the detection method is applicable to the monitoring of disease occurrence in fields as well as the rapid and high-throughput detection and identification of pathogenic bacteria.

Description

technical field [0001] The invention relates to a detection method for Botrytis, in particular to a triple real-time fluorescent PCR detection method for Botrytis, which belongs to the technical field of inspection and quarantine. Background technique [0002] The fungi of Botryosphaeriaceae have a wide range of hosts. They not only exist in the soil but also parasitize healthy plants as endophytic fungi. They infect plants and cause diseases when they encounter suitable environmental conditions, causing plants to wither, rot and ulcers. . Botryosphaeria stevensii (Botryosphaeria stevensii and Botryosphaeria obtusa, Botryosphaeria dothidea) is an entry quarantine pest in my country. It produces toxins that seriously damage apples, pears, grapes and other fruit trees, causing huge economic losses to the apple industry. [0003] Accurate and rapid detection and identification of pathogenic bacteria is an important basis for studying the occurrence, development and population ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12R1/645
CPCC12Q1/6851C12Q1/6895C12Q2600/16C12Q2531/113C12Q2537/143C12Q2561/101
Inventor 高文娜况卫刚郑春生骆卫峰张百怡
Owner PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com