Botryosphaeria dothidea detection method
A technology of Vitis vinifera and probe, applied in the field of inspection and quarantine, can solve the problems of affecting the detection accuracy of multiplex fluorescent PCR, excessive melting temperature difference, and increasing difficulty of multiplex PCR, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] Embodiment 1: the establishment of real-time fluorescent PCR system
[0080] 1. Detection of three fungal primers and probe design
[0081]According to the gene sequence of Botrytis EF1a published by GenBank, multiple alignments were performed to find out the conserved gene sequence. According to the design principles of primers and probes, the specificity of the three fungi was designed using Primer Express3.0 (Applied Biosystems) and Primer premier 5.0 Primer probe, and then verify the specificity of primer and probe by BLAST tool (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi), the sequence is as follows:
[0082] B. stevensii primer Bst-F: TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
[0083] B. stevensii Primer Bst-R: CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
[0084] B. stevensii probe Bst-T: TGCGCTTATCTGCCGCCGTG (SEQ ID No.3)
[0085] B. obtusa primer Bob-F: TCATCGAGAAGTTCGAGAAGGTAAG (SEQ ID No.1)
[0086] B. obtusa primer Bob-R: CAAGTGCGGCCAGTTTGC (SEQ ID No.2)
[0087] B. obt...
Embodiment 2
[0098] Embodiment 2: real-time PCR detection method specificity test
[0099] 1. Source of materials
[0100] Collect apple and pear ulcer branches and fruit with rotten symptoms, and use the conventional tissue PDA separation method to isolate and purify the strains. Some strains were purchased from ATCC and China Forestry Microbiology Collection Center CFCC, B. stevensii ATCC60259, B. stevensii ATCC64483, B. stevensii CFCC84208 , B. obtusa CFCC86564, B. dothidea bjsd-1, B. rhodina CFCC88424, B. rhodina CFCC88423, B. parva CFCC-88098, Lasiodiplodia crassispora CFCC87129. B. iberica bjbi-1. Magnetic nanoparticles were purchased from Promega.
[0101] 2. Fungal DNA Extraction
[0102] The tested strains were cultured on PDA medium at 28°C for 5-7 days, the bacteria cake was shaken in PDB for 5-7 days, and the mycelium was dried under sterile conditions for later use. Take about 100mg of mycelium and put it in a 1.5ml centrifuge tube, and use the magnetic bead method for nucl...
Embodiment 3
[0105] Embodiment 3: the sensitivity test of multiple real-time PCR detection method
[0106] 1. Method
[0107] Extract the genomic DNA of the tested strains B.stevensiiATCC60259, B.obtusa CFCC-86564, and B.dothidea bjsd-1 respectively, and use a UV spectrophotometer (NanoDrop Nano-1000, Thermo scientific) to measure the DNA concentration, and then perform a 10-fold serial concentration gradient Dilute, dilute to 10ng / μL, 1ng / μL, 10 -1 ng / μL, 10 -2 ng / μL, 10 -3 ng / μL, 10 -4 ng / μL, 10 -5 ng / μL, 10 -6 ng / μL eight concentration gradients, the three kinds of fungal DNA were mixed in equal proportions for real-time fluorescence detection, each concentration was repeated three times, and no DNA template was used as a negative control, and a standard curve was established according to the Ct value.
[0108] 2. Results
[0109] B.dothidea, B.obtusa, and B.stevensii three kinds of fungal DNA were mixed in equal proportions and diluted 10 times, and then multiple real-time fluor...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com