HMG1 gene and application of HMG1 gene in silkworm microsporidia molecular detection
A technology of microsporidia and silkworm, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of detection interference, less sensitivity of primers, low sensitivity, etc., and achieve the effect of increasing range, convenient use, and wide application range
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1 Microsporidia Bombyx mori HMG 1 Gene
[0040] 1. According to the method of gene homologous cloning in the gene cloning technology of molecular biology, No. silkworm was cloned and obtained HMG 1 Gene cDNA and full-length DNA sequences.
[0041] 2. Obtaining the full length of cDNA, the specific method is as follows:
[0042] (1) Using Primer premier 5.0 software, combined with comprehensive analysis, the primers primers HMG1F / HMG1R were designed, and the sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.
[0043] Upstream primer HMG1F (SEQ ID NO.3):
[0044] 5' ATGACTGCTCAAAAAGACGATAC 3'
[0045] Downstream primer HMG1R (SEQ ID NO.4):
[0046] 5'TTATTCATCACTATTCTCCTACTTCT 3'.
[0047] (2) Using the purified spore DNA of N.b. silkworm (N.b) as a template, PCR amplification was performed with primers HMG1F / HMG1R.
[0048] (3) The PCR product was purified, connected to pMD19T, and transformed into E, coli DH-5α for culture.
[0049] ...
Embodiment 2
[0053] Example 2 Detection primer design and establishment of PCR amplification method
[0054] 1. Primer design
[0055] Bombyx mori HMG 1 On the basis of genes, multiple pairs of primers were designed by using Primer premier 5.0 software. Through a large number of drug resistance, specificity and sensitivity tests, three pairs of primers were finally selected as representative primer sets. The primer sequences of each set are as follows:
[0056] (1) The first pair:
[0057] Upstream primer HMG1F (SEQ ID NO.3):
[0058] 5' ATGACTGCTCAAAAAGACGATAC 3'
[0059] Downstream primer HMG1R (SEQ ID NO.4):
[0060] 5'TTATTCATCACTATTCTCCTACTTCT 3'.
[0061] (2) The second pair:
[0062] Upstream primer HMG1-sF (SEQ ID NO.5):
[0063] TTCCGAAATAATCTTCTTTTAATTG
[0064] Downstream primer HMG1-sR (SEQ ID NO.6):
[0065] TTGTGCACCGAATCGTAAATAG
[0066] (3) The third pair:
[0067] Upstream primer HMG1-xF (SEQ ID NO.7):
[0068] TCCCTAGGAACTTTTAAAGAGAAG
[0069] Downstream...
Embodiment 3
[0091] Example 3 Primer Specific Detection
[0092] 1. Using the DNA of No. silkworm (N.b), No. tussah mori (N.a), and No. corn borer (N.f) as templates, primers HMG1F / HMG1R, HMG1-sF / HMG1-sR, HMG1-xF / HMG1-xR, carry out PCR amplification with the method of embodiment 2, agarose gel electrophoresis detection result after amplification is finished.
[0093] 2. The amplification results of the three pairs of primers are shown in the attached Figure 4~6 shown. The results showed that only primers HMG1-sF / HMG1-sR could specifically detect Bombyx mori microsporidia, while primers HMG1F / HMG1R and primers HMG1-xF / HMG1-xR could detect all microsporidia, and had good generality. Detectable, but not specific for N. silkworm.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com