Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vector for efficiently secreting and expressing heterogenous protein, and its application

A technology for secreting and expressing heterologous proteins is applied in the field of vectors for efficient secreting and expressing heterologous proteins, which can solve the problems of low secretion efficiency of signal peptides, and achieve the effects of improving water solubility, saving time and improving efficiency.

Inactive Publication Date: 2015-02-11
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the deficiency of low secretion efficiency of signal peptides used in existing secretion expression vectors, to provide a signal peptide for efficient secretion and expression of heterologous proteins, as well as a recombinant expression vector containing the signal peptide and its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector for efficiently secreting and expressing heterogenous protein, and its application
  • Vector for efficiently secreting and expressing heterogenous protein, and its application
  • Vector for efficiently secreting and expressing heterogenous protein, and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Construction of vector pCT7-CHISP6H for high-efficiency secretion and expression of heterologous proteins in Escherichia coli.

[0029] (1) Amplification of the signal peptide sequence of the chitosanase gene of Microbacterium sp.OU01

[0030] Using the genomic DNA of Microbacterium sp.OU01 as a template and CHISP-F / CHISP-R as a primer pair, perform PCR amplification;

[0031] Primers are:

[0032] CHISP-F: GC CATATG AAGATTCAACGACTTG (the underlined part is the Nde I restriction site)

[0033] CHISP-R: GC GAATTCGTGCAC CATCACCATCACCATGGAGGCAGCGCACCCG CT (The underlined part is the EcoR I restriction site; the double underlined part is the PmaC I restriction site; the bold part is the 6×His tag sequence)

[0034] The PCR reaction system is 20ul, as follows:

[0035]

[0036] PCR amplification program: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, a total of 30 cycles; final extension at ...

Embodiment 2

[0057] Construction of recombinant expression vector pCT7-CHISP6H-mschito of chitosanase mature peptide of Microbacterium sp.OU01, induced expression, separation and purification and activity analysis.

[0058] (1) Microbacterium sp.OU01 chitosanase mature peptide sequence amplification and fragment recovery

[0059] Combination according to the mature peptide sequence information of Microbacterium sp.OU01 chitosanase HD Clontech kit instructions, design primers to amplify its mature peptide sequence, the primer sequence is as follows:

[0060] pCT7-CHISP6H-mschitoF: CATCACCATCACCAC TCCGCCGAAACGGCCGGGA (the underlined sequence is the 15bp sequence matching the linearized vector pCT7-CHISP6H)

[0061] pCT7-CHISP6H-mschitoR: AAGCTTCGAATTCAC CTAGTTCAGGGAGAACTGG (the underlined sequence is the 15bp sequence matching the linearized vector pCT7-CHISP6H)

[0062] Using pCT7-CHISP6H-mschitoF / pCT7-CHISP6H-mschitoR as a primer pair and the genomic DNA of Microbacterium sp.OU01 as...

Embodiment 3

[0076] Construction of expression vector, recombinant expression and activity analysis of Bacillus sp.S-1 chitosanase using expression vector pCT7-CHISP6H

[0077] In order to test the universality of the signal peptide, the chitosanase of Gram-positive bacteria Bacillus sp.S-1 (registration number: EU924147) was used to test in this expression system, and the recombinant expression vector pCT7-CHISP6H-Bschito Construction method is the same as embodiment 2, and concrete operation is as follows:

[0078] The primer sequences designed to amplify the mature peptide of Bacillus sp.S-1 chitosanase are as follows:

[0079] pCT7-CHISP6H-bschitoF:

[0080] CATCACCATCACCAC GCAAGTGTAACGGACAATTC (the underlined sequence is the 15bp sequence matching the linearized vector pCT7-CHISP6H)

[0081] pCT7-CHISP6H-bschitoR:

[0082] AAGCTTCGAATTCAC TTAATTATCGTATCCTTCATAAATCGC (the underlined sequence is the 15bp sequence matching the linearized vector pCT7-CHISP6H)

[0083] Using pCT7-C...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an expression vector in the gene engineering field, and concretely relates to a vector for efficiently secreting and expressing a heterologous protein, and its application. An encoding signal peptide for efficiently secreting and expressing the heterologous protein is represented by a base sequence in SEQID NO.1. The vector for efficiently secreting and expressing the heterologous protein contains a specific nucleotide sequence, the sequence is the nucleotide sequence of a promoter and the encoding signal peptide; structure diagrams comprise a promoter sequence, a nucleotide sequence encoding the signal peptide, a 6*His tag sequence and a PmaCI restriction enzyme site; and the promoter is a T7 promoter, and the encoding signal peptide is a chitosan enzyme signal peptide of microbacterium (Microbacterium sp.OU01). The vector can efficiently secreting and expressing exogenous gene and also can effectively improve the water solubility of expression products, and a recombinant protein with biological activity can be obtained by using affinity chromatography one-step purification.

Description

technical field [0001] The invention relates to an expression vector in the field of genetic engineering, in particular to a vector for highly secreting and expressing a heterologous protein and its application. Background technique [0002] With the development of molecular biology technology and the advancement of large-scale sequencing technology, a large number of functional genes with important application prospects have been excavated. Functional proteins with biological activity can be obtained through recombinant expression of functional genes by genetic engineering. The in vitro recombinant expression system of protein includes prokaryotic expression system and eukaryotic expression system. The prokaryotic expression system represented by Escherichia coli has the advantages of simple operation, rapid expression and high efficiency, and has become the most concerned expression system. [0003] In the Escherichia coli in vitro recombinant expression system, problems ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/31C07K14/195C12N15/63C12N15/66C12N9/42
Inventor 张继泉孙玉英相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com