Genetically engineered bacterium for efficiently expressing catechins as well as construction method and application thereof
A genetically engineered bacteria, high-efficiency expression technology, applied in microorganism-based methods, biochemical equipment and methods, bacteria, etc., can solve problems such as safety risks, consumption of large tea leaves, and organic reagents affecting the quality of finished products.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Construction of Genetically Engineered Bacteria Highly Expressing Catechin
[0027] 1) Amplification of DFR and LAR sequences
[0028] According to the registered DFR and LAR sequences, design double restriction primers to amplify the sequences with Xho I and Nde I restriction sites.
[0029] The primer sequence corresponding to DFR is DFR-Nde I / F: CATATGATGAAAGACTCTGTTGC, DFR-Xho I / R: CTCGAGTTAAACCTTGTTGCCATTG;
[0030] The primer sequence corresponding to LAR is LAR-Nde I / F: CATATGATGACTGTGTTGGAATCTG, LAR-Xho I / R: CTCGAGTCAAAGCACACATTGTGATG;
[0031] The tea tree cDNA was used as a template, and the above primers were used for amplification.
[0032] Among them, the PCR reaction system is: 1 μL template, 10 μL 5×buffer, 0.5 μL high-fidelity enzyme, 4 μL dNTP Mix, 1 μL upstream and downstream primers, 32.5 μL sterile water. The PCR amplification conditions were: 98°C for 10s, 62°C for 15s, and 72°C for 30s. After the program ends, the product is recovered...
Embodiment 2
[0039] Example 2 Utilize the genetically engineered bacteria of Example 1 to produce catechins
[0040] 1) Inoculate the constructed genetically engineered bacteria into 20 mL of LB medium containing 50 μg / mL Kan and 50 μg / mL Amp, cultivate overnight at 37°C and 200 rpm; and 50 μg / mL Amp LB medium, cultivated to OD600=0.5; adding IPTG with a final concentration of 1 mmol / L to induce at 28°C for 5 hours.
[0041] 2) Preparation of catechins: Substrate DHQ was added to the above cultured bacterial solution, and the culture was continued overnight. Centrifuge at 4°C and 5000 rpm to take the supernatant, extract with an equal volume of ethyl acetate, and then perform rotary evaporation with a rotary evaporator to obtain catechin powder. After the methanol is dissolved, it is detected by high performance liquid phase, and the detection results are as follows: figure 2 shown.
[0042] Depend on figure 2It can be seen that (C is catechin), the bacterial strain of the present in...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com