Clone of plant manganese poison-resistant important gene ShMDH1 and application thereof

A plant, manganese-tolerant technology, applied in the field of plant biology

Inactive Publication Date: 2014-01-22
SOUTH CHINA AGRI UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the key genes controlling Mn toxicity tolerance in Stylophyllum have not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Clone of plant manganese poison-resistant important gene ShMDH1 and application thereof
  • Clone of plant manganese poison-resistant important gene ShMDH1 and application thereof
  • Clone of plant manganese poison-resistant important gene ShMDH1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] ShMDH1 gene cloning

[0048] 1, ShMDH1 gene cloning

[0049] According to protein two-dimensional electrophoresis, a protein up-regulated by manganese poisoning was identified as malate dehydrogenase. Then, based on the reported nucleotide sequences of soybean (XM_003527163), alfalfa (AF020271), japonicus japonicus (BT146072) and castor (XM_002524216) genes for homology comparison, upstream homologous primers were designed in highly conserved regions5 '- ATTATTGCCGCTGAGGTTTTTCAAGA -3' (SEQ ID NO:3) and the downstream homologous primer 5'- GATTCCCTTCAAGCAAGCATCG -3' (SEQ ID NO:4), using the TRIzol method to extract total RNA from the root system of the fine-stem manganese-tolerant genotype of Stylophyllum styloides, Then it was reverse-transcribed into cDNA and used as a template for PCR amplification. The PCR reaction system was 20 μL, including 0.5 μL of 10 μM upstream and downstream primers, 2 μL of 10×PCR buffer, 1.6 μL of 2.5 mM dNTP, and Ex-Taq (TAKARA Company) ...

Embodiment 2

[0071] Research on genetically modified materials

[0072] 1. Obtaining genetically modified materials

[0073] 1) Obtaining transgenic Arabidopsis plants

[0074] will construct a good overexpression ShMDH1 The vector plasmid was transformed into Agrobacterium tumefaciens Gv3101, and transgenic Arabidopsis plants were obtained by Agrobacterium-mediated Arabidopsis inflorescence transfection method.

[0075] 2) Obtaining of transgenic yeast strains

[0076] According to the method of SC easy comp transformation kit (Invitrogen Company), the constructed yeast expression ShMDH1 Vector plasmid and pYES2 empty vector were transformed into yeast INVSC1 (Invitrogen).

[0077] 2. Detection of genetically modified materials

[0078] 1) Detection of transgenic Arabidopsis plants

[0079] After the T1 generation Arabidopsis seeds were screened for hygromycin resistance, the T1 generation transgenic plants were obtained, and the seeds were harvested; the T2 generation seeds were sc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a clone of a key gene ShMDH1 promoting the manganese poison resistance of a plant and an application thereof. The nucleotide sequence of the ShMDH1 is shown by SEQ ID No:1, and the amino acid sequence of the coded protein is shown by SEQ ID No:2. The ShMDH1 gene regulates the synthesis and secretion of malic acid of stylosanthes guianensis, and plays an important role in enhancing the manganese resistance of the plant.

Description

technical field [0001] The invention relates to the field of plant biotechnology, in particular to a manganese toxicity-resistant gene ShMDH1 cloning and its application. Background technique [0002] More than 50% of the potential arable soils in the world are acidic soils, mainly distributed in tropical, subtropical and temperate regions (Kochian et al., 2004). In acidic soils, in addition to phosphorus deficiency and aluminum toxicity, manganese toxicity is also an important obstacle to crop growth and yield (de Carvalho et al., 1980; Horst et al., 1988; Raghothama, 1999; Vance et al., 2003). Manganese is one of the essential trace elements for plant growth (Mukhopadhyay and Sharma, 1991). However, excess manganese can also cause toxic effects on plants. Symptoms of manganese toxicity generally manifest as brown manganese oxidation spots on leaves, reduction of chlorophyll content, weakening of photosynthesis and other symptoms, which ultimately inhibit plant growth a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00
Inventor 田江廖红陈志坚
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap