Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Drugs for treating liver cancer and application of raco-1 monoclonal antibody

A RACO-1 and monoclonal antibody technology, applied in the direction of antibodies, drug combinations, anti-tumor drugs, etc., to achieve the effect of reducing the invasion and metastasis of liver cancer, improving the five-year survival rate, and low side effects

Inactive Publication Date: 2015-10-28
THE FOURTH AFFILIATED HOSPITAL OF ZHEJIANG UNIV SCHOOL OF MEDICINE
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The present invention aims to provide a drug for treating liver cancer and the application of RACO-1 monoclonal antibody to solve the technical problem of improving the survival rate of liver cancer patients in clinical treatment in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drugs for treating liver cancer and application of raco-1 monoclonal antibody
  • Drugs for treating liver cancer and application of raco-1 monoclonal antibody
  • Drugs for treating liver cancer and application of raco-1 monoclonal antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0040] According to another typical embodiment of the present invention, the sequence of the upstream primer used for cloning RACO-1 DNA is shown in SEQ ID NO: 3 (5'-TCAGGGAGAGAAAGGAAGACTG-3'); the sequence of the downstream primer is shown in SEQ ID NO: 4 (5 '-GTGGACAGAGCGACTTGGATAA -3').

[0041] In the present invention, an application of a RACO-1 monoclonal antibody in the preparation of a drug for treating liver cancer is provided, wherein the RACO-1 monoclonal antibody is a human RACO-1 monoclonal antibody, which interferes with the expression of the RACO-1 gene as a treatment for liver cancer. a method of

[0042] The present invention will be further described below in conjunction with embodiment.

Embodiment 1

[0044] 1) Extraction of total RNA and cloning of RACO-1 gene by reverse transcription PCR.

[0045] Total RNA in peripheral blood lymphocytes of patients with primary hepatocellular carcinoma with high expression of RACO-1 (primary hepatocellular carcinoma patient, female, 41 years old) was extracted by one-step method of guanidinium thiocyanate-phenol-chloroform. Take about 20 μg of total RNA, add 1 μg OligodT, 5ul 250mmol / LdNTP and 200UM-MLV reverse transcriptase (GIBCOLBRL), and carry out cDNA synthesis according to the product instructions. PCR amplification of the RACO-1 gene, wherein the amplification primers are as follows: the sequence of the upstream primer is SEQ ID NO: 1 NO: 1 (5'-aacaaggggtctgtggaaatc-3'); the sequence of the downstream primer is SEQ ID NO: 2 (5' -tgtagtcggtcagtgccttct-3'). The conditions of PCR amplification were: denaturation at 94°C for 20 min, annealing at 52°C for 50 s, extension at 72°C for 1.5 min, 35 cycles in total, and finally extension ...

Embodiment 2

[0059] PCR amplification of RACO-1 gene (from a patient with primary hepatocellular carcinoma, female, 48 years old), wherein the amplification primers are as follows: the sequence of the upstream primer is as shown in SEQ ID NO: 3 (5'- TCAGGGAGAGAAAGGAAGACTG-3' ); the sequence of the downstream primer is SEQ ID NO: 4 (5'- GTGGACAGAGCGACTTGGATAA -3'). All the other experimental conditions were the same as in Example 1.

[0060] In the following experiments, the RACO-1 monoclonal antibody was added to the cell culture medium to treat the cells.

[0061] The monoclonal antibody that embodiment 1 obtains is carried out in vitro test operation as follows:

[0062] The cells required for the experiment (HCCLM3 control and HCCLM3 anti-RACO-1 and MHCC97-H control and MHCC97-H anti-RACO-1 ), all instruments that can be sterilized are sterilized, and the ruler and marker pen are irradiated with ultraviolet rays for 30 minutes before operation. Digest the cells with 0.25% trypsin,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a drug for treating liver cancer and an application of an RACO-1 monoclonal antibody. The drug for treating the liver cancer disclosed by the invention comprises effective dose of RACO-1 monoclonal antibody, wherein the RACO-1 monoclonal antibody is a human RACO-1 monoclonal antibody; the human RACO-1 monoclonal antibody is prepared by the following steps: extracting total ribonucleic acid (RNA) of peripheral blood lymphocyte of a sufferer with primary hepatocellular carcinoma, cloning RACO-1 deoxyribonucleic acid (DNA) by a reverse transcription polymerase chain reaction (PCR) method; building a phage antibody library by adopting the RACO-1 DNA; screening the phage antibody library to obtain target bacteria; extracting plasmid DNA from the target bacteria, cutting off a phage coat protein gene III in the plasmid DNA, and expressing and purifying the other part of plasmid DNA, so as to obtain the human RACO-1 monoclonal antibody. The drug disclosed by the invention has the advantages of being good in specificity, high in affinity, small in immunogenicity, low in side effect and the like.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a drug for treating liver cancer and the application of RACO-1 monoclonal antibody. Background technique [0002] Hepatocellular carcinoma (HCC) is the fifth most common tumor in men worldwide, with the characteristics of poor prognosis and high mortality, which seriously threatens the lives and health of Chinese people. Although in recent years, with the continuous improvement of imaging diagnosis and surgical technology and the emergence of targeted therapy drugs for liver cancer represented by Sorafenib, it has provided possible and more effective treatment options for the early diagnosis and treatment of liver cancer. The treatment level of liver cancer has been improved to a certain extent. However, looking at the current clinical treatment status of liver cancer, there is still a lack of truly effective drugs for liver cancer with few side effects. The postoperative re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/395C12N15/70A61P1/16A61P35/00
Inventor 徐江锋刘细玉
Owner THE FOURTH AFFILIATED HOSPITAL OF ZHEJIANG UNIV SCHOOL OF MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com