Application of OsHSF08 gene in controlling rice drought resistance
A drought resistance, genetic technology, applied in application, genetic engineering, plant genetic improvement and other directions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1: Isolation of OsHSF08T-DNA insertion mutants
[0026] From the rice mutant library RMD (the starting material of the present invention is the mutant 03Z11CE69 retrieval address: http: / / rmd.ncpgr.cn / search.cgi, managed by the State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University). The T-DNA insertion mutant 03Z11CE69 corresponding to the gene site induced by stress-induced increase, wherein the flanking sequence of the OsHSF08T-DNA mutant 03Z11CE69 (the sequence length is 847bp):
[0027] TCTTTGTGTTTGCAATTTGCAGGGTTTCAGAAAGATTGATCCTGACAGATGGGAATTCGCGAATGATGGTTTCCTGAGAGGCCAGAGGCATCTTCTAAAGATGATTAAGAGGAGGAGACCATTGTCTTATCTCCCTGGATCTCAGCAGGCACTTGGCACCTGCCTTGAGGTTGGTCAGTTCGGATTAGATGAAGAGATCGACAGGCTAAAGCGTGACAAGAACATCTTACTCGCGGAGGTTGTGAAACTAAGGCACAAGCAGCAAAGCACGAAAGCCAATATGCGAGCCATGGAAGAGAGGCTGCAACATGCGGAGCAGAAGCAGGTCCAGATGATGGGTTTCTTGGCAAGAGCAATGCAGAACCCTGACTTCTTTCACCAGTTGATTCACCAGCAGGATAAAATGAAGGGGCTCGAGGACACATTCTCGAAGAAGAGGACGAGGTCGATAGA...
Embodiment 2
[0030] Embodiment 2: Detection of the expression level of rice endogenous OsHSF08 gene
[0031] We selected the japonica rice variety "Zhonghua 11" (abbreviated as ZH11, Institute of Crop Science, Chinese Academy of Agricultural Sciences, a rice variety publicly promoted and applied) as the material for expression profile analysis. After seed germination, various abiotic stresses and hormone treatments were carried out when the seeds were grown to the four-leaf stage in normal soil in small buckets. Drought treatment is to let it dry naturally without watering, and samples are taken before the stress, 1 day, 2 days, and 3 days after the stress, and 1 day after rehydration; low temperature stress is to put the four-leaf stage rice seedlings into artificial climate at 4 °C In the chamber, samples were taken before stress and 1.5 hours, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, and 48 hours after stress. For hormone treatment, 200 μM abscisic acid (ABA) was evenly sprayed...
Embodiment 3
[0033] Example 3: Identification of OsHSF08 mutant phenotype observations under normal growth conditions
[0034] In order to study the function of OsHSF08 gene, we planted three independent homozygous families of OsHSF08 mutants OsHSF08-M1, OsHSF08-M2, OsHSF08-M3 and three independent negative families OsHSF08-N1, OsHSF08-N2, OsHSF08-N3, measure their tiller angle and flag leaf angle at the heading stage. The tiller angle is the angle between the effective tiller and the vertical direction. Each individual plant is measured and compared to the four outer tillers. Each 10 individual plants were tested in the family. According to the measurement statistics, it was found that the tiller angle of the OsHSF08 homozygous mutant was about 45 degrees, while the tiller angle of the negative control family was about 28 degrees, which was significantly lower than that of the homozygous mutant ( Figure 4 A). The angle between the flag leaves at the heading stage is measured by selecti...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com