Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Corn transcription factor ZmWRKY44 and application thereof

A transcription factor, corn technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc.

Inactive Publication Date: 2013-09-18
SICHUAN AGRI UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, maize WRKY genes have been found to be related to maize diseases, but there are few reports related to salt stress

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corn transcription factor ZmWRKY44 and application thereof
  • Corn transcription factor ZmWRKY44 and application thereof
  • Corn transcription factor ZmWRKY44 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] 1. Cloning of ZmWRKY44 gene

[0027] The specific primer W44F / R of ZmWRKY44 was used to amplify the cDNA of this gene from maize inbred line 178, and the target band of ZmWRKY44 gene 1282bp was obtained (such as figure 1 ). It was recovered and sequenced, further proving that the cloned fragment was the ZmWRKY44 gene.

[0028] W44F: atCCCGGGCAGAAAGTCAGGGGTAGGGAGA

[0029] W44R: atCCCGGGGAAGAATCTGTCTCTTCTAGAGACCG

[0030] ZmWRKY44 gene sequence:

[0031] ATCCCGGCAGAAAGTCAGGGTAGGGAGAAGGATGGCGATGGCGATGGCAAGTATGCC GCCGGCTTGTGCGGCAACCGAGCTGGTGGCCAAGGGGAGGGAGTCGGCTGCAGTTCTCAA GGCCATGCTCGGCCAGCTTCCTGCGGCGGCGACGCCCCATGATGGTCTCCGGGATCTGGCC GAGCAGGTCCTCCGCTGCTGCGACCGAGCTCTGGCGGCCTTGCTCAGAGGCGCGGCAACG GAGGAGGCTGCCTGCAGCAGTTCGGCCAGGAAGCGCCGCAAGCAGCCAGCAGAGCGGCA GGGCGGCCTGGCTCCTCCTCCTCCTTCTCCTGCTGCGACGGGATCCAAGACCAAGAGGATG AGGTAATTACTACTATGCAGCATAGCTCCTTTTGAGCTAATTACCAGCTTAAGTATACAACGT ATAATCATCTACTACTGAATCTGCAGGATGAGCCGTGGAGAGCGGGGGACACGAGCGGAGA AGAAAGAAACAATGGAGGACGGCTTCATCTGGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant stress resistance, and in particular relates to a corn transcription factor ZmWRKY44 and an application thereof. The corn transcription factor ZmWRKY44 has a nucleotide sequence as shown in SEQ ID No.1. According to the technical scheme, the expression condition of the adversity-tolerant gene of a transcription factor ZmWRKY44 arabidopsis plant under a salt stress condition is observed, the influence on the seed germination rate of the transcription factor ZmWRKY44 abrabidopsis plant caused by salt stress is relieved, and the plant growth is inhibited, so that a transgenic plant has a proper sensibility to the salt stress, and the transcription factor ZmWRKY44 can be used for enabling the plants to have a salt-tolerance property.

Description

technical field [0001] The invention relates to the field of plant stress resistance, in particular to maize transcription factor ZmWRKY44 and its application. Background technique [0002] As an important food, feed and economic ternary crop in my country, corn is affected by various adverse external environments such as pests, drought, salt damage, cold damage, and high temperature during its growth, thereby inhibiting its growth and development. Applying modern molecular biology techniques to excavate important stress-resistant genes and carry out genetic transformation or aggregate them with other excellent traits through molecular marker-assisted selection is one of the effective methods to obtain maize varieties with strong stress tolerance and improve maize yield. one. Functional research on stress-related genes is a prerequisite for the development and utilization of these genes. WRKY transcription factors play an important regulatory role in plant biotic stress, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/84A01H5/00
Inventor 张素芝王娜李洪有卢文黄盈梁晓玲王红玲黄凤珠徐栓栓覃小俏
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com