Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant protein PACAP38-NtA, and coding gene and application thereof

A recombinant protein, pacap38-nta technology, which is applied in the field of recombinant protein, can solve the problems of long repair time and large amount of use, and achieve the effect of good repair function, less use amount, and good effect of promoting corneal repair

Active Publication Date: 2013-06-12
广州恒宁生物科技有限公司
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, it has an important role in promoting nerve repair and corneal sensory function recovery after corneal flap surgery, while only using PACAP38 to act on the cornea and corneal nerve, although it also has a certain repair effect, but its usage is large and the repair time is long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein PACAP38-NtA, and coding gene and application thereof
  • Recombinant protein PACAP38-NtA, and coding gene and application thereof
  • Recombinant protein PACAP38-NtA, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Design the amino acid sequences of PACAP38-NtA protein and PACAP27-NtA, the sequences are as follows:

[0055] Amino acid sequence of PACAP38-NtA:

[0056] HSDGIFTDSYSRYRKQMAVKKYLAAVLGKRYKQRIKNKGSGGGSGGGGSGGGGSNCPERELQEEEEEANVVLTGTVEEIMNDVPVHHTYSCKVRVWRYLKGKDIVTHEILLDGGNKVVIGGFGDPLICDNQVSTGDFTTRIFFVNPAPQYMWPAHRNELMLNSSLMRITLRNLEEETPKVEEEKLL;

[0057] Amino acid sequence of PACAP27-NtA:

[0058] HSDGIFTDSYSRYRKQMAVKKYLAAVLGSGGGSGGGGSGGGGSNCPERELQEEEEEANVVLTGTVEEIMNDVPVHHTYSCKVRVWRYLKGKDIVTHEILLDGGNKVVIGGFGDPLICDNQVSTGDTRIFFVNPAPQYMWPAHRNELMLNSSLMRITLRNLEEVEHCVEEHRKLLPAKPNSYFTQTPNSYFTQTPS.

[0059] According to the codon preference of Escherichia coli, the nucleotide sequences are speculated as follows:

[0060] Nucleotide sequence encoding PACAP38-NtA:

[0061] CACTCTGACGGTATCTTCACCGACTCTTACTCTCGTTACCGTAAACAGATGGCTGTTAAAAAATACCTGGCTGCTGTTCTGGGTAAACGTTACAAACAGCGTATCAAAAACAAAGGTTCTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTAACTGCCCGGAACGTGAACTGCAGGAAGAAGAAGAAGAAGCTAACGTT...

Embodiment 2

[0080] Expression of fusion gene expression vectors pET-3c / PACAP38-NtA and pET-3c / PACAP27-NtA in Escherichia coli BL21 (DE3).

[0081] Inoculate Escherichia coli DH5α clones containing recombinant vectors pET-3c / PACAP38-NtA and pET-3c / PACAP27-NtA in liquid LB medium containing 50 μg / ml ampicillin and 34 μg / ml chloramphenicol, respectively, at 37°C After culturing for 12 hours, the plasmid DNA was extracted with the Omega plasmid extraction kit.

[0082] Transform the pET-3c / PACAP38-NtA and pET-3c / PACAP27-NtA plasmids into Escherichia coli BL21 (DE3) (purchased from Novagen) competent cells (the preparation method of the competent cells is the same as the ice CaCl mentioned above) 2 Law). During transformation, take 100 μg of the purified pET-3c / PACAP38-NtA and pET-3c / PACAP27-NtA plasmids as DNA samples to transform Escherichia coli BL21 (DE3), and the obtained expression strains are respectively denoted as PACAP38-NtA / BL21 (DE3) and PACAP27-NtA / BL21 (DE3). Keep the recombin...

Embodiment 3

[0089] Example 3 Fermentation and cultivation of recombinant protein in small-scale bioreactors

[0090] The PACAP38-NtA / BL21 (DE3) and PACAP27-NtA / BL21 (DE3) bacterial classifications obtained in Example 2 are respectively carried out the scale-up culture of shaking flask, promptly by volume percentage 2% inoculum size is inoculated in two 5mL containing 50 μ g / ml of liquid LB medium containing ampicillin and 34 μg / ml chloramphenicol, cultured on a shaker at 37°C for 12 hours, and then transferred to 300 mL containing 50 μg / ml ampicillin and 34 μg / ml chloramphenicol according to the volume percentage of 2% inoculum In the liquid LB medium (shake flask: 1000mL), culture at 37°C and 180rpm for 12h to obtain 300ml seed liquid.

[0091] Pour 3L of fermentation medium into the fermenter, install pH and dissolved oxygen electrodes on the fermenter, seal the outlet of the pipeline with cotton and tin foil, and sterilize at 121°C for 18 minutes. Seed feeding bottles, acid-base feed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant protein PACAP38-NtA, and a coding gene and application thereof. The amino acid sequence of the recombinant protein PACAP38-NtA is disclosed as SEQ ID NO.1. The nucleotide sequence for coding the recombinant protein PACAP38-NtA is disclosed as SEQ ID NO.2. The nucleotide sequence disclosed as SEQ ID NO.2 is cloned into a prokaryotic expression vector pET-3c, and transfected into Escherichia coli BL21(DE3) to obtain the expression recombinant protein PACAP38-NtA strain. According to the invention, a minitype bioreactor is utilized to ferment the strain, and a two-step purification method comprising common ion-exchange chromatography and nickel-column affinity chromatography, which is simple to operate, is utilized to obtain the high-purity target protein. The obtained recombinant PACAP38-NtA fusion protein can be specifically combined with laminin, can effectively promote proliferation and differentiation of neuron-like cells PC12, and can enhance the restorability of the injured part when acting on the mouse corneal scratched part; and the recombinant PACAP38-NtA fusion protein can be can be used for preparing medicines for restoring corneal injuries.

Description

technical field [0001] The invention relates to a recombinant protein, in particular to a recombinant protein PACAP38-NtA, its encoding gene and application. Background technique [0002] Pituitary Adenylate Cyclase-activating Polypeptide (Pituitary Adenylate Cyclase-activating Polypeptide, PACAP) is a polypeptide with a wide range of biological activities discovered by Miyata et al. A new member of the glucagon / vasoactive intestinal peptide (VlP) family. [0003] PACAP exists in two forms in vivo, PACAP38 containing 38 amino acids and PACAP27, a truncated peptide lacking 11 amino acids at the carboxy-terminus. PACAP38 is more abundant and more active than PACAP27 in tissues. PACAP and its receptors are not only distributed in the central nervous system and peripheral nervous system, but also widely distributed in surrounding tissues and organs, such as pancreas, islets, digestive tract, gonads, etc. PACAP has three main receptors: PACIR, VPACIR and VPAC2R. PACIR is the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C07K1/22C07K1/18C12N15/62C12N1/21C12N15/70C12P21/02A61K38/17A61K47/48A61P27/02C12R1/19
Inventor 洪岸吴陆生陈小佳
Owner 广州恒宁生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com